Multiple sequence alignment - TraesCS5A01G039600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G039600 chr5A 100.000 4657 0 0 1 4657 36192638 36197294 0.000000e+00 8600.0
1 TraesCS5A01G039600 chr5A 98.863 4572 48 4 1 4568 36163601 36168172 0.000000e+00 8152.0
2 TraesCS5A01G039600 chr5A 98.841 4572 47 5 1 4568 36073262 36077831 0.000000e+00 8144.0
3 TraesCS5A01G039600 chr5A 98.968 3197 30 3 1 3195 36101424 36104619 0.000000e+00 5718.0
4 TraesCS5A01G039600 chr5A 99.142 3148 24 3 1 3146 36129953 36133099 0.000000e+00 5661.0
5 TraesCS5A01G039600 chr5A 98.855 2708 29 2 1863 4568 36048351 36051058 0.000000e+00 4828.0
6 TraesCS5A01G039600 chr5A 99.194 1240 10 0 3329 4568 36133093 36134332 0.000000e+00 2235.0
7 TraesCS5A01G039600 chr5A 99.162 1194 10 0 3375 4568 36104616 36105809 0.000000e+00 2150.0
8 TraesCS5A01G039600 chr5A 88.525 854 97 1 2793 3645 36020907 36021760 0.000000e+00 1033.0
9 TraesCS5A01G039600 chr5A 99.806 516 1 0 1 516 36047834 36048349 0.000000e+00 948.0
10 TraesCS5A01G039600 chr5A 98.018 454 7 2 2499 2950 36034568 36035021 0.000000e+00 787.0
11 TraesCS5A01G039600 chr5A 99.536 431 2 0 1 431 36047042 36047472 0.000000e+00 785.0
12 TraesCS5A01G039600 chr5A 85.125 558 67 11 1742 2287 304895352 304894799 1.460000e-154 556.0
13 TraesCS5A01G039600 chr5A 88.194 288 18 8 921 1206 36020247 36020520 3.470000e-86 329.0
14 TraesCS5A01G039600 chr5A 96.970 99 3 0 4559 4657 36051090 36051188 2.880000e-37 167.0
15 TraesCS5A01G039600 chr5A 95.960 99 4 0 4559 4657 36105840 36105938 1.340000e-35 161.0
16 TraesCS5A01G039600 chr5A 95.960 99 4 0 4559 4657 36134363 36134461 1.340000e-35 161.0
17 TraesCS5A01G039600 chr5A 94.949 99 4 1 4559 4657 36077863 36077960 2.240000e-33 154.0
18 TraesCS5A01G039600 chr5A 98.667 75 1 0 4583 4657 36168215 36168289 2.920000e-27 134.0
19 TraesCS5A01G039600 chr5A 83.516 91 10 5 2358 2445 43264652 43264740 3.860000e-11 80.5
20 TraesCS5A01G039600 chr5D 86.878 1326 137 29 2336 3645 45213172 45214476 0.000000e+00 1450.0
21 TraesCS5A01G039600 chr5D 86.355 535 61 8 1755 2287 488839272 488838748 1.450000e-159 573.0
22 TraesCS5A01G039600 chr5D 91.803 366 25 4 851 1214 45212657 45213019 5.380000e-139 505.0
23 TraesCS5A01G039600 chr5D 83.258 221 25 4 3655 3865 498298570 498298788 4.760000e-45 193.0
24 TraesCS5A01G039600 chr5D 81.373 204 26 6 3442 3645 45283909 45284100 6.240000e-34 156.0
25 TraesCS5A01G039600 chr5B 92.405 869 66 0 2777 3645 45241958 45242826 0.000000e+00 1240.0
26 TraesCS5A01G039600 chr5B 85.174 344 28 15 874 1214 45240894 45241217 9.660000e-87 331.0
27 TraesCS5A01G039600 chr5B 81.818 187 21 8 3666 3846 661316827 661317006 1.350000e-30 145.0
28 TraesCS5A01G039600 chr1A 89.518 706 71 2 1334 2036 532368154 532367449 0.000000e+00 891.0
29 TraesCS5A01G039600 chr1A 82.716 81 14 0 2365 2445 31918826 31918906 6.460000e-09 73.1
30 TraesCS5A01G039600 chr1A 81.928 83 14 1 2363 2445 31961288 31961369 8.360000e-08 69.4
31 TraesCS5A01G039600 chrUn 99.074 432 4 0 2863 3294 476253797 476254228 0.000000e+00 776.0
32 TraesCS5A01G039600 chr2B 84.868 760 82 22 1231 1977 760745215 760745954 0.000000e+00 736.0
33 TraesCS5A01G039600 chr4B 86.432 597 60 13 1222 1811 575830596 575831178 6.570000e-178 634.0
34 TraesCS5A01G039600 chr4B 86.265 597 61 13 1222 1811 575855560 575856142 3.060000e-176 628.0
35 TraesCS5A01G039600 chr7D 86.786 560 56 11 1742 2288 38624485 38625039 3.980000e-170 608.0
36 TraesCS5A01G039600 chr7D 100.000 38 0 0 3810 3847 12386923 12386960 2.320000e-08 71.3
37 TraesCS5A01G039600 chr6D 89.228 492 46 6 1231 1719 295146939 295146452 3.980000e-170 608.0
38 TraesCS5A01G039600 chr6A 86.154 520 61 7 1742 2257 594236374 594235862 6.810000e-153 551.0
39 TraesCS5A01G039600 chr3B 81.625 566 84 14 1742 2294 558497415 558496857 7.110000e-123 451.0
40 TraesCS5A01G039600 chr1B 75.325 847 163 38 2819 3639 100037414 100038240 9.520000e-97 364.0
41 TraesCS5A01G039600 chr1D 83.750 240 24 6 3655 3881 411128546 411128783 3.650000e-51 213.0
42 TraesCS5A01G039600 chr2A 83.010 206 30 4 3672 3875 1188545 1188747 1.030000e-41 182.0
43 TraesCS5A01G039600 chr2A 89.855 69 6 1 3806 3873 26604001 26603933 2.310000e-13 87.9
44 TraesCS5A01G039600 chr3D 83.582 201 24 1 3655 3846 580370064 580370264 3.700000e-41 180.0
45 TraesCS5A01G039600 chr3A 84.146 82 8 4 2362 2440 681134001 681134080 1.800000e-09 75.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G039600 chr5A 36192638 36197294 4656 False 8600.000000 8600 100.000000 1 4657 1 chr5A.!!$F2 4656
1 TraesCS5A01G039600 chr5A 36073262 36077960 4698 False 4149.000000 8144 96.895000 1 4657 2 chr5A.!!$F6 4656
2 TraesCS5A01G039600 chr5A 36163601 36168289 4688 False 4143.000000 8152 98.765000 1 4657 2 chr5A.!!$F9 4656
3 TraesCS5A01G039600 chr5A 36129953 36134461 4508 False 2685.666667 5661 98.098667 1 4657 3 chr5A.!!$F8 4656
4 TraesCS5A01G039600 chr5A 36101424 36105938 4514 False 2676.333333 5718 98.030000 1 4657 3 chr5A.!!$F7 4656
5 TraesCS5A01G039600 chr5A 36047042 36051188 4146 False 1682.000000 4828 98.791750 1 4657 4 chr5A.!!$F5 4656
6 TraesCS5A01G039600 chr5A 36020247 36021760 1513 False 681.000000 1033 88.359500 921 3645 2 chr5A.!!$F4 2724
7 TraesCS5A01G039600 chr5A 304894799 304895352 553 True 556.000000 556 85.125000 1742 2287 1 chr5A.!!$R1 545
8 TraesCS5A01G039600 chr5D 45212657 45214476 1819 False 977.500000 1450 89.340500 851 3645 2 chr5D.!!$F3 2794
9 TraesCS5A01G039600 chr5D 488838748 488839272 524 True 573.000000 573 86.355000 1755 2287 1 chr5D.!!$R1 532
10 TraesCS5A01G039600 chr5B 45240894 45242826 1932 False 785.500000 1240 88.789500 874 3645 2 chr5B.!!$F2 2771
11 TraesCS5A01G039600 chr1A 532367449 532368154 705 True 891.000000 891 89.518000 1334 2036 1 chr1A.!!$R1 702
12 TraesCS5A01G039600 chr2B 760745215 760745954 739 False 736.000000 736 84.868000 1231 1977 1 chr2B.!!$F1 746
13 TraesCS5A01G039600 chr4B 575830596 575831178 582 False 634.000000 634 86.432000 1222 1811 1 chr4B.!!$F1 589
14 TraesCS5A01G039600 chr4B 575855560 575856142 582 False 628.000000 628 86.265000 1222 1811 1 chr4B.!!$F2 589
15 TraesCS5A01G039600 chr7D 38624485 38625039 554 False 608.000000 608 86.786000 1742 2288 1 chr7D.!!$F2 546
16 TraesCS5A01G039600 chr6A 594235862 594236374 512 True 551.000000 551 86.154000 1742 2257 1 chr6A.!!$R1 515
17 TraesCS5A01G039600 chr3B 558496857 558497415 558 True 451.000000 451 81.625000 1742 2294 1 chr3B.!!$R1 552
18 TraesCS5A01G039600 chr1B 100037414 100038240 826 False 364.000000 364 75.325000 2819 3639 1 chr1B.!!$F1 820

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1947 2873 3.535561 GGCATGTAGTCTAGTTGCACAT 58.464 45.455 13.33 0.0 35.04 3.21 F
2906 4368 1.086696 CGATCAACAACATCGGCCTT 58.913 50.000 0.00 0.0 39.62 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3200 4662 1.203013 TCCTGGAAAGACGAGAGGTGA 60.203 52.381 0.0 0.0 0.0 4.02 R
3819 5659 4.471904 TTCGCATATTTCAGTGAGGTCT 57.528 40.909 0.0 0.0 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1947 2873 3.535561 GGCATGTAGTCTAGTTGCACAT 58.464 45.455 13.33 0.00 35.04 3.21
2000 2926 1.674519 CGTCGAAACATCCCCATGTGA 60.675 52.381 0.00 0.00 42.89 3.58
2011 2937 5.888161 ACATCCCCATGTGAAATCTACTTTC 59.112 40.000 0.00 0.00 42.05 2.62
2084 3010 3.065371 CACGAGGATTGAAAGTTATGCCC 59.935 47.826 0.00 0.00 0.00 5.36
2321 3267 7.809238 TGGAATTGAGAGATGAGAATGGTATT 58.191 34.615 0.00 0.00 0.00 1.89
2906 4368 1.086696 CGATCAACAACATCGGCCTT 58.913 50.000 0.00 0.00 39.62 4.35
3200 4662 3.069980 GCACTCCATCGGCGTCTCT 62.070 63.158 6.85 0.00 0.00 3.10
3563 5403 2.034879 CAATGACTTCGCCGCCACT 61.035 57.895 0.00 0.00 0.00 4.00
3819 5659 9.998106 TGAAATTTCGGGGTTAAAAATATTTCA 57.002 25.926 13.34 0.00 0.00 2.69
3849 5689 9.888878 CTCACTGAAATATGCGAAATTTCATAT 57.111 29.630 17.99 11.64 46.65 1.78
4394 6234 4.576216 ATGTATTTTGGCACACGTGAAA 57.424 36.364 25.01 12.23 39.29 2.69
4434 6274 4.495422 GAGAATTTTCTCGAGCTACCACA 58.505 43.478 7.81 0.00 43.63 4.17
4611 6493 4.096003 CTTCGGGATGGTGGCGGT 62.096 66.667 0.00 0.00 0.00 5.68
4612 6494 4.402528 TTCGGGATGGTGGCGGTG 62.403 66.667 0.00 0.00 0.00 4.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
2000 2926 4.557205 ACGTGCTCTTCGAAAGTAGATTT 58.443 39.130 0.00 0.0 36.90 2.17
2011 2937 2.720758 CCTCGCAACGTGCTCTTCG 61.721 63.158 8.07 0.0 42.25 3.79
3200 4662 1.203013 TCCTGGAAAGACGAGAGGTGA 60.203 52.381 0.00 0.0 0.00 4.02
3819 5659 4.471904 TTCGCATATTTCAGTGAGGTCT 57.528 40.909 0.00 0.0 0.00 3.85
4394 6234 9.579932 AAAATTCTCCTTCATTAAGTTCAGTCT 57.420 29.630 0.00 0.0 0.00 3.24
4434 6274 5.507482 CCGATGTGACGAAAGAGGTATATGT 60.507 44.000 0.00 0.0 35.09 2.29


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.