Multiple sequence alignment - TraesCS5A01G039400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G039400 chr5A 100.000 4469 0 0 1 4469 36129953 36134421 0.000000e+00 8253.0
1 TraesCS5A01G039400 chr5A 98.950 4477 37 7 1 4469 36101424 36105898 0.000000e+00 7998.0
2 TraesCS5A01G039400 chr5A 99.142 3148 24 3 1 3147 36192638 36195783 0.000000e+00 5661.0
3 TraesCS5A01G039400 chr5A 99.079 3150 26 3 1 3147 36163601 36166750 0.000000e+00 5653.0
4 TraesCS5A01G039400 chr5A 98.825 3149 34 2 1 3147 36073262 36076409 0.000000e+00 5607.0
5 TraesCS5A01G039400 chr5A 98.947 1330 13 1 3141 4469 36049819 36051148 0.000000e+00 2377.0
6 TraesCS5A01G039400 chr5A 98.720 1328 16 1 3141 4467 36076592 36077919 0.000000e+00 2357.0
7 TraesCS5A01G039400 chr5A 98.911 1286 12 2 1864 3147 36048351 36049636 0.000000e+00 2296.0
8 TraesCS5A01G039400 chr5A 98.758 1288 15 1 3141 4427 36166933 36168220 0.000000e+00 2289.0
9 TraesCS5A01G039400 chr5A 99.194 1240 10 0 3141 4380 36195966 36197205 0.000000e+00 2235.0
10 TraesCS5A01G039400 chr5A 99.419 516 3 0 1 516 36047834 36048349 0.000000e+00 937.0
11 TraesCS5A01G039400 chr5A 100.000 431 0 0 1 431 36047042 36047472 0.000000e+00 797.0
12 TraesCS5A01G039400 chr5A 98.238 454 7 1 2499 2951 36034568 36035021 0.000000e+00 793.0
13 TraesCS5A01G039400 chr5A 88.732 355 39 1 2794 3147 36020907 36021261 2.470000e-117 433.0
14 TraesCS5A01G039400 chr5A 89.274 317 34 0 3141 3457 36021444 36021760 9.010000e-107 398.0
15 TraesCS5A01G039400 chr5A 87.847 288 19 8 921 1206 36020247 36020520 1.550000e-84 324.0
16 TraesCS5A01G039400 chr5A 94.915 59 3 0 4411 4469 36197196 36197254 4.760000e-15 93.5
17 TraesCS5A01G039400 chr5A 82.418 91 10 6 2359 2445 43264652 43264740 1.720000e-09 75.0
18 TraesCS5A01G039400 chr5A 100.000 35 0 0 4435 4469 36168215 36168249 1.040000e-06 65.8
19 TraesCS5A01G039400 chr1A 89.660 706 70 2 1335 2037 532368154 532367449 0.000000e+00 896.0
20 TraesCS5A01G039400 chr1A 82.716 81 13 1 2366 2445 31918826 31918906 2.230000e-08 71.3
21 TraesCS5A01G039400 chr1A 81.928 83 13 2 2364 2445 31961288 31961369 8.020000e-08 69.4
22 TraesCS5A01G039400 chr5D 83.918 827 96 30 2337 3147 45213172 45213977 0.000000e+00 756.0
23 TraesCS5A01G039400 chr5D 86.916 535 58 6 1756 2288 488839272 488838748 1.380000e-164 590.0
24 TraesCS5A01G039400 chr5D 91.530 366 26 4 851 1214 45212657 45213019 2.400000e-137 499.0
25 TraesCS5A01G039400 chr5D 91.798 317 26 0 3141 3457 45214160 45214476 4.100000e-120 442.0
26 TraesCS5A01G039400 chr5D 80.882 204 27 7 3254 3457 45283909 45284100 2.780000e-32 150.0
27 TraesCS5A01G039400 chr2B 84.893 748 81 21 1231 1966 760745215 760745942 0.000000e+00 726.0
28 TraesCS5A01G039400 chr2B 88.947 190 19 2 3502 3689 732580739 732580928 2.690000e-57 233.0
29 TraesCS5A01G039400 chr2B 83.060 183 30 1 3512 3693 771227479 771227661 9.950000e-37 165.0
30 TraesCS5A01G039400 chr4B 86.432 597 61 12 1222 1812 575830596 575831178 1.750000e-178 636.0
31 TraesCS5A01G039400 chr4B 86.265 597 62 12 1222 1812 575855560 575856142 8.160000e-177 630.0
32 TraesCS5A01G039400 chr7D 86.964 560 55 11 1743 2289 38624485 38625039 8.220000e-172 614.0
33 TraesCS5A01G039400 chr7D 88.535 157 18 0 3493 3649 593396550 593396394 1.640000e-44 191.0
34 TraesCS5A01G039400 chr6D 89.047 493 46 6 1231 1720 295146939 295146452 4.940000e-169 604.0
35 TraesCS5A01G039400 chr6D 80.688 523 81 16 1743 2255 436849467 436848955 5.420000e-104 388.0
36 TraesCS5A01G039400 chr6A 86.923 520 57 5 1743 2258 594236374 594235862 1.390000e-159 573.0
37 TraesCS5A01G039400 chrUn 99.296 284 2 0 2864 3147 476253797 476254080 8.570000e-142 514.0
38 TraesCS5A01G039400 chr5B 91.848 368 30 0 2778 3145 45241958 45242325 8.570000e-142 514.0
39 TraesCS5A01G039400 chr5B 95.584 317 14 0 3141 3457 45242510 45242826 3.990000e-140 508.0
40 TraesCS5A01G039400 chr5B 84.884 344 29 15 874 1214 45240894 45241217 4.310000e-85 326.0
41 TraesCS5A01G039400 chr2D 87.952 166 19 1 3493 3658 579393438 579393602 1.270000e-45 195.0
42 TraesCS5A01G039400 chr1B 75.841 327 56 20 3141 3451 100037921 100038240 1.300000e-30 145.0
43 TraesCS5A01G039400 chr3A 82.927 82 8 5 2363 2440 681134001 681134080 8.020000e-08 69.4


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G039400 chr5A 36129953 36134421 4468 False 8253.000000 8253 100.000000 1 4469 1 chr5A.!!$F3 4468
1 TraesCS5A01G039400 chr5A 36101424 36105898 4474 False 7998.000000 7998 98.950000 1 4469 1 chr5A.!!$F2 4468
2 TraesCS5A01G039400 chr5A 36073262 36077919 4657 False 3982.000000 5607 98.772500 1 4467 2 chr5A.!!$F7 4466
3 TraesCS5A01G039400 chr5A 36163601 36168249 4648 False 2669.266667 5653 99.279000 1 4469 3 chr5A.!!$F8 4468
4 TraesCS5A01G039400 chr5A 36192638 36197254 4616 False 2663.166667 5661 97.750333 1 4469 3 chr5A.!!$F9 4468
5 TraesCS5A01G039400 chr5A 36047042 36051148 4106 False 1601.750000 2377 99.319250 1 4469 4 chr5A.!!$F6 4468
6 TraesCS5A01G039400 chr5A 36020247 36021760 1513 False 385.000000 433 88.617667 921 3457 3 chr5A.!!$F5 2536
7 TraesCS5A01G039400 chr1A 532367449 532368154 705 True 896.000000 896 89.660000 1335 2037 1 chr1A.!!$R1 702
8 TraesCS5A01G039400 chr5D 488838748 488839272 524 True 590.000000 590 86.916000 1756 2288 1 chr5D.!!$R1 532
9 TraesCS5A01G039400 chr5D 45212657 45214476 1819 False 565.666667 756 89.082000 851 3457 3 chr5D.!!$F2 2606
10 TraesCS5A01G039400 chr2B 760745215 760745942 727 False 726.000000 726 84.893000 1231 1966 1 chr2B.!!$F2 735
11 TraesCS5A01G039400 chr4B 575830596 575831178 582 False 636.000000 636 86.432000 1222 1812 1 chr4B.!!$F1 590
12 TraesCS5A01G039400 chr4B 575855560 575856142 582 False 630.000000 630 86.265000 1222 1812 1 chr4B.!!$F2 590
13 TraesCS5A01G039400 chr7D 38624485 38625039 554 False 614.000000 614 86.964000 1743 2289 1 chr7D.!!$F1 546
14 TraesCS5A01G039400 chr6D 436848955 436849467 512 True 388.000000 388 80.688000 1743 2255 1 chr6D.!!$R2 512
15 TraesCS5A01G039400 chr6A 594235862 594236374 512 True 573.000000 573 86.923000 1743 2258 1 chr6A.!!$R1 515
16 TraesCS5A01G039400 chr5B 45240894 45242826 1932 False 449.333333 514 90.772000 874 3457 3 chr5B.!!$F1 2583

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1692 2529 0.175073 CAACCAGTCTACTACCCCGC 59.825 60.000 0.00 0.0 0.00 6.13 F
2252 3232 4.807039 GACGGGCCGCTCGCTAAA 62.807 66.667 28.71 0.0 37.74 1.85 F
3276 4968 2.310538 CTCCAGAACAGGGTGCTTTTT 58.689 47.619 0.00 0.0 0.00 1.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
3276 4968 1.135527 CGCATAACCCAGTCGGACTTA 59.864 52.381 8.18 0.0 34.64 2.24 R
3458 5150 7.657336 CAGTGAGCTCCAAAATTAAAAACCTA 58.343 34.615 12.15 0.0 0.00 3.08 R
4156 5848 8.434392 AGACAAAGTGTAGACCATTAAACCTAA 58.566 33.333 0.00 0.0 0.00 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1692 2529 0.175073 CAACCAGTCTACTACCCCGC 59.825 60.000 0.00 0.0 0.00 6.13
2252 3232 4.807039 GACGGGCCGCTCGCTAAA 62.807 66.667 28.71 0.0 37.74 1.85
3276 4968 2.310538 CTCCAGAACAGGGTGCTTTTT 58.689 47.619 0.00 0.0 0.00 1.94
3458 5150 1.417890 CAGAGTCACCAACCAGAACCT 59.582 52.381 0.00 0.0 0.00 3.50
4156 5848 1.356124 ACTGAGTCTGTGGAATGCCT 58.644 50.000 1.31 0.0 34.31 4.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1692 2529 6.533730 TGCAATCCACTAATAGATAGTTGGG 58.466 40.000 0.00 0.0 42.31 4.12
2689 3726 9.809096 TGTATAATTTCATGTGTTTTTGTGTGT 57.191 25.926 0.00 0.0 0.00 3.72
3276 4968 1.135527 CGCATAACCCAGTCGGACTTA 59.864 52.381 8.18 0.0 34.64 2.24
3458 5150 7.657336 CAGTGAGCTCCAAAATTAAAAACCTA 58.343 34.615 12.15 0.0 0.00 3.08
4156 5848 8.434392 AGACAAAGTGTAGACCATTAAACCTAA 58.566 33.333 0.00 0.0 0.00 2.69


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.