Multiple sequence alignment - TraesCS5A01G039200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G039200 chr5A 100.000 4659 0 0 1 4659 36073262 36077920 0.000000e+00 8604.0
1 TraesCS5A01G039200 chr5A 98.832 4622 48 5 1 4618 36163601 36168220 0.000000e+00 8231.0
2 TraesCS5A01G039200 chr5A 98.841 4572 47 5 1 4570 36192638 36197205 0.000000e+00 8144.0
3 TraesCS5A01G039200 chr5A 98.718 3198 38 2 1 3197 36101424 36104619 0.000000e+00 5675.0
4 TraesCS5A01G039200 chr5A 98.825 3149 34 2 1 3148 36129953 36133099 0.000000e+00 5607.0
5 TraesCS5A01G039200 chr5A 98.856 2798 28 3 1863 4658 36048351 36051146 0.000000e+00 4987.0
6 TraesCS5A01G039200 chr5A 98.720 1328 16 1 3331 4658 36133093 36134419 0.000000e+00 2357.0
7 TraesCS5A01G039200 chr5A 98.674 1282 16 1 3377 4658 36104616 36105896 0.000000e+00 2272.0
8 TraesCS5A01G039200 chr5A 88.642 854 96 1 2795 3647 36020907 36021760 0.000000e+00 1038.0
9 TraesCS5A01G039200 chr5A 100.000 516 0 0 1 516 36047834 36048349 0.000000e+00 953.0
10 TraesCS5A01G039200 chr5A 98.458 454 6 1 2500 2952 36034568 36035021 0.000000e+00 798.0
11 TraesCS5A01G039200 chr5A 99.536 431 2 0 1 431 36047042 36047472 0.000000e+00 785.0
12 TraesCS5A01G039200 chr5A 88.194 288 18 8 921 1206 36020247 36020520 3.480000e-86 329.0
13 TraesCS5A01G039200 chr5A 92.982 57 4 0 4602 4658 36197196 36197252 2.990000e-12 84.2
14 TraesCS5A01G039200 chr5D 87.029 1326 135 30 2338 3647 45213172 45214476 0.000000e+00 1461.0
15 TraesCS5A01G039200 chr5D 86.406 537 59 6 1755 2289 488839272 488838748 4.040000e-160 575.0
16 TraesCS5A01G039200 chr5D 91.803 366 25 4 851 1214 45212657 45213019 5.380000e-139 505.0
17 TraesCS5A01G039200 chr5D 83.710 221 24 4 3657 3867 498298570 498298788 1.020000e-46 198.0
18 TraesCS5A01G039200 chr5D 81.373 204 26 7 3444 3647 45283909 45284100 6.240000e-34 156.0
19 TraesCS5A01G039200 chr5B 92.520 869 65 0 2779 3647 45241958 45242826 0.000000e+00 1245.0
20 TraesCS5A01G039200 chr5B 84.900 351 29 16 874 1220 45240894 45241224 2.690000e-87 333.0
21 TraesCS5A01G039200 chr1A 89.407 708 69 4 1335 2038 532368154 532367449 0.000000e+00 887.0
22 TraesCS5A01G039200 chr1A 86.885 61 5 3 3800 3859 511634513 511634455 1.080000e-06 65.8
23 TraesCS5A01G039200 chrUn 100.000 432 0 0 2865 3296 476253797 476254228 0.000000e+00 798.0
24 TraesCS5A01G039200 chr2B 90.220 501 41 8 1226 1721 476380106 476379609 0.000000e+00 647.0
25 TraesCS5A01G039200 chr4B 86.767 597 58 13 1222 1811 575830596 575831178 0.000000e+00 645.0
26 TraesCS5A01G039200 chr4B 86.600 597 59 13 1222 1811 575855560 575856142 1.410000e-179 640.0
27 TraesCS5A01G039200 chr6D 89.293 495 44 7 1231 1721 295146939 295146450 3.080000e-171 612.0
28 TraesCS5A01G039200 chr7D 85.943 562 59 11 1742 2290 38624485 38625039 2.420000e-162 582.0
29 TraesCS5A01G039200 chr6A 86.398 522 58 6 1742 2259 594236374 594235862 4.070000e-155 558.0
30 TraesCS5A01G039200 chr3D 82.079 558 82 13 1742 2289 500662470 500663019 1.180000e-125 460.0
31 TraesCS5A01G039200 chr3D 83.582 201 24 1 3657 3848 580370064 580370264 3.700000e-41 180.0
32 TraesCS5A01G039200 chr3D 89.091 55 5 1 3814 3867 559226456 559226402 3.010000e-07 67.6
33 TraesCS5A01G039200 chr3B 81.866 568 81 14 1742 2296 558497415 558496857 4.250000e-125 459.0
34 TraesCS5A01G039200 chr1B 75.414 846 164 37 2821 3641 100037414 100038240 2.050000e-98 370.0
35 TraesCS5A01G039200 chr1B 91.667 48 1 3 3814 3859 47204914 47204868 3.890000e-06 63.9
36 TraesCS5A01G039200 chr1D 84.167 240 23 6 3657 3883 411128546 411128783 7.850000e-53 219.0
37 TraesCS5A01G039200 chr7A 89.362 47 3 2 3814 3858 19165434 19165480 1.810000e-04 58.4
38 TraesCS5A01G039200 chr2A 96.970 33 1 0 3674 3706 677889388 677889356 6.510000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G039200 chr5A 36073262 36077920 4658 False 8604.000000 8604 100.0000 1 4659 1 chr5A.!!$F2 4658
1 TraesCS5A01G039200 chr5A 36163601 36168220 4619 False 8231.000000 8231 98.8320 1 4618 1 chr5A.!!$F3 4617
2 TraesCS5A01G039200 chr5A 36192638 36197252 4614 False 4114.100000 8144 95.9115 1 4658 2 chr5A.!!$F8 4657
3 TraesCS5A01G039200 chr5A 36129953 36134419 4466 False 3982.000000 5607 98.7725 1 4658 2 chr5A.!!$F7 4657
4 TraesCS5A01G039200 chr5A 36101424 36105896 4472 False 3973.500000 5675 98.6960 1 4658 2 chr5A.!!$F6 4657
5 TraesCS5A01G039200 chr5A 36047042 36051146 4104 False 2241.666667 4987 99.4640 1 4658 3 chr5A.!!$F5 4657
6 TraesCS5A01G039200 chr5A 36020247 36021760 1513 False 683.500000 1038 88.4180 921 3647 2 chr5A.!!$F4 2726
7 TraesCS5A01G039200 chr5D 45212657 45214476 1819 False 983.000000 1461 89.4160 851 3647 2 chr5D.!!$F3 2796
8 TraesCS5A01G039200 chr5D 488838748 488839272 524 True 575.000000 575 86.4060 1755 2289 1 chr5D.!!$R1 534
9 TraesCS5A01G039200 chr5B 45240894 45242826 1932 False 789.000000 1245 88.7100 874 3647 2 chr5B.!!$F1 2773
10 TraesCS5A01G039200 chr1A 532367449 532368154 705 True 887.000000 887 89.4070 1335 2038 1 chr1A.!!$R2 703
11 TraesCS5A01G039200 chr4B 575830596 575831178 582 False 645.000000 645 86.7670 1222 1811 1 chr4B.!!$F1 589
12 TraesCS5A01G039200 chr4B 575855560 575856142 582 False 640.000000 640 86.6000 1222 1811 1 chr4B.!!$F2 589
13 TraesCS5A01G039200 chr7D 38624485 38625039 554 False 582.000000 582 85.9430 1742 2290 1 chr7D.!!$F1 548
14 TraesCS5A01G039200 chr6A 594235862 594236374 512 True 558.000000 558 86.3980 1742 2259 1 chr6A.!!$R1 517
15 TraesCS5A01G039200 chr3D 500662470 500663019 549 False 460.000000 460 82.0790 1742 2289 1 chr3D.!!$F1 547
16 TraesCS5A01G039200 chr3B 558496857 558497415 558 True 459.000000 459 81.8660 1742 2296 1 chr3B.!!$R1 554
17 TraesCS5A01G039200 chr1B 100037414 100038240 826 False 370.000000 370 75.4140 2821 3641 1 chr1B.!!$F1 820

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1219 2015 6.527423 AGTTGCCATCATTTGATTTTGAAGT 58.473 32.000 0.0 0.0 31.21 3.01 F
1906 2748 1.740025 GCAGAAGGACTATTGGCACAC 59.260 52.381 0.0 0.0 39.29 3.82 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2273 3191 1.782028 AAAAGGACGCGTCAAGCCAC 61.782 55.000 37.26 20.56 44.76 5.01 R
3812 5446 9.489084 CATATTTCAGTGAGGTCCGAAATATTA 57.511 33.333 14.34 0.00 43.47 0.98 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1219 2015 6.527423 AGTTGCCATCATTTGATTTTGAAGT 58.473 32.000 0.00 0.00 31.21 3.01
1390 2225 2.560542 TCACGCACATTTATTTGGCCTT 59.439 40.909 3.32 0.00 0.00 4.35
1466 2302 4.545823 TTTCATCGTTGGATAAATCGCC 57.454 40.909 0.00 0.00 0.00 5.54
1906 2748 1.740025 GCAGAAGGACTATTGGCACAC 59.260 52.381 0.00 0.00 39.29 3.82
1907 2749 2.875672 GCAGAAGGACTATTGGCACACA 60.876 50.000 0.00 0.00 39.29 3.72
3812 5446 7.948034 TCTACATTGAAATTTCGGGGTTAAT 57.052 32.000 13.34 3.88 0.00 1.40
4064 5698 5.129815 AGGCCAAAGGTCGTGTATAATAAGA 59.870 40.000 5.01 0.00 29.39 2.10
4411 6045 4.750098 CACGTGAAGGACTGAACTTAATGT 59.250 41.667 10.90 0.00 30.32 2.71
4488 6122 5.246981 TGATCTGGTCCAAGTGAGAAAAT 57.753 39.130 0.00 0.00 0.00 1.82
4581 6215 2.273776 GCTGGAAAGGCCTCCTCC 59.726 66.667 21.97 21.97 36.35 4.30
4584 6218 1.463214 TGGAAAGGCCTCCTCCACA 60.463 57.895 25.84 10.19 36.35 4.17
4590 6224 4.035102 GCCTCCTCCACACACCCC 62.035 72.222 0.00 0.00 0.00 4.95
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1466 2302 5.294552 GGGATCTAGTTTCCAAAATCTCGTG 59.705 44.000 13.95 0.00 34.77 4.35
1906 2748 0.378257 GCCAACCGAGCATATGTGTG 59.622 55.000 4.29 0.00 0.00 3.82
1907 2749 1.089481 CGCCAACCGAGCATATGTGT 61.089 55.000 4.29 0.00 40.02 3.72
2271 3189 4.980805 GGACGCGTCAAGCCACCA 62.981 66.667 37.26 0.00 44.76 4.17
2273 3191 1.782028 AAAAGGACGCGTCAAGCCAC 61.782 55.000 37.26 20.56 44.76 5.01
3812 5446 9.489084 CATATTTCAGTGAGGTCCGAAATATTA 57.511 33.333 14.34 0.00 43.47 0.98
4064 5698 3.640967 TGTTTTTGCAAGGGTCTATGCTT 59.359 39.130 0.00 0.00 42.97 3.91
4290 5924 0.179073 GGAGCGGTGATGTGCTACAT 60.179 55.000 0.00 2.02 41.85 2.29
4488 6122 3.258123 GGGCAGCTTGATACCTTTTGAAA 59.742 43.478 0.00 0.00 0.00 2.69
4636 6311 4.096003 CCGCCACCATCCCGAAGT 62.096 66.667 0.00 0.00 0.00 3.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.