Multiple sequence alignment - TraesCS5A01G037700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G037700 chr5A 100.000 2988 0 0 1 2988 34928393 34931380 0 5518
1 TraesCS5A01G037700 chr5A 97.492 2991 69 6 1 2988 141917010 141914023 0 5103
2 TraesCS5A01G037700 chr5A 97.291 2990 72 7 1 2988 541991869 541988887 0 5064
3 TraesCS5A01G037700 chr5A 97.125 2991 78 8 1 2988 142236868 142239853 0 5040
4 TraesCS5A01G037700 chr7A 97.361 2994 67 8 1 2988 245421148 245424135 0 5081
5 TraesCS5A01G037700 chr6A 97.259 2992 73 9 1 2988 158968494 158971480 0 5062
6 TraesCS5A01G037700 chr3A 97.158 2991 81 4 1 2988 417408384 417405395 0 5049
7 TraesCS5A01G037700 chr3A 97.126 2992 78 8 1 2988 34460439 34463426 0 5042
8 TraesCS5A01G037700 chr2A 97.192 2991 74 9 1 2988 266697357 266694374 0 5049
9 TraesCS5A01G037700 chr2A 97.158 2991 77 8 2 2988 572954952 572957938 0 5046


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G037700 chr5A 34928393 34931380 2987 False 5518 5518 100.000 1 2988 1 chr5A.!!$F1 2987
1 TraesCS5A01G037700 chr5A 141914023 141917010 2987 True 5103 5103 97.492 1 2988 1 chr5A.!!$R1 2987
2 TraesCS5A01G037700 chr5A 541988887 541991869 2982 True 5064 5064 97.291 1 2988 1 chr5A.!!$R2 2987
3 TraesCS5A01G037700 chr5A 142236868 142239853 2985 False 5040 5040 97.125 1 2988 1 chr5A.!!$F2 2987
4 TraesCS5A01G037700 chr7A 245421148 245424135 2987 False 5081 5081 97.361 1 2988 1 chr7A.!!$F1 2987
5 TraesCS5A01G037700 chr6A 158968494 158971480 2986 False 5062 5062 97.259 1 2988 1 chr6A.!!$F1 2987
6 TraesCS5A01G037700 chr3A 417405395 417408384 2989 True 5049 5049 97.158 1 2988 1 chr3A.!!$R1 2987
7 TraesCS5A01G037700 chr3A 34460439 34463426 2987 False 5042 5042 97.126 1 2988 1 chr3A.!!$F1 2987
8 TraesCS5A01G037700 chr2A 266694374 266697357 2983 True 5049 5049 97.192 1 2988 1 chr2A.!!$R1 2987
9 TraesCS5A01G037700 chr2A 572954952 572957938 2986 False 5046 5046 97.158 2 2988 1 chr2A.!!$F1 2986

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
370 372 2.124151 GGTATGCTGGCCAGGTGG 60.124 66.667 33.46 10.38 38.53 4.61 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1993 2011 0.033503 TGACGGCATCTCCAGGACTA 60.034 55.0 0.0 0.0 34.01 2.59 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
93 94 4.165779 GGTATGTGTTTTGTACTGCATGC 58.834 43.478 11.82 11.82 0.00 4.06
287 289 6.048732 TCCTATACTCATTGTTTGCAGTGA 57.951 37.500 0.00 0.00 38.72 3.41
370 372 2.124151 GGTATGCTGGCCAGGTGG 60.124 66.667 33.46 10.38 38.53 4.61
395 397 8.637986 GGGGCTTGTCATTGTATTGATTAATTA 58.362 33.333 0.00 0.00 0.00 1.40
614 618 2.244510 TGCATCAATTGAGGGGTGGTAT 59.755 45.455 20.68 0.00 0.00 2.73
659 663 7.818930 TGAACTTGTGCAATCTTTTCTTTTTCT 59.181 29.630 0.00 0.00 0.00 2.52
747 754 6.952773 TGTTTTCATTTACAGCCTGTTAGT 57.047 33.333 1.02 0.00 0.00 2.24
805 812 3.243704 CGGAAAAGTTGCCTTGGATGAAA 60.244 43.478 0.00 0.00 0.00 2.69
982 989 4.469945 CCTCTGATGGGAGTTTTGTACCTA 59.530 45.833 0.00 0.00 0.00 3.08
1086 1094 0.534203 TTGGTTTCTCTCGTGGTGGC 60.534 55.000 0.00 0.00 0.00 5.01
1288 1296 5.009210 GTGTTTATGAAGGTTGTGTTGCCTA 59.991 40.000 0.00 0.00 34.15 3.93
1299 1307 0.913934 TGTTGCCTAGATCTGCCCCA 60.914 55.000 5.18 0.00 0.00 4.96
1374 1382 6.122277 GGCTAATATGGATTATTGCCAGCTA 58.878 40.000 0.00 0.00 40.48 3.32
1933 1949 8.583765 GTTGCGTTGATTGATTAACTATTTTCC 58.416 33.333 0.00 0.00 0.00 3.13
1993 2011 3.598019 TTTCCGAGTGTATAAACGGCT 57.402 42.857 0.00 0.00 44.19 5.52
2037 2055 6.055588 TCTCAAGTTCCGAAGTTTTCATCTT 58.944 36.000 0.00 0.00 0.00 2.40
2247 2268 4.494199 GCGTTTGAGCTGTATCAATGGTAC 60.494 45.833 0.00 0.00 38.90 3.34
2275 2296 5.360714 TCCTGAAGGTCATCAATTTAATGCC 59.639 40.000 0.00 0.12 36.34 4.40
2328 2349 7.173218 GGAGAGAATTTTAATCGGTGATATGCA 59.827 37.037 0.00 0.00 0.00 3.96
2512 2533 3.178046 TGGTGATGGTACTGAGGCTAAA 58.822 45.455 0.00 0.00 0.00 1.85
2695 2717 0.103755 GATCACGATGAGGCTGCTGA 59.896 55.000 0.00 0.00 0.00 4.26
2724 2746 1.694150 GCAGGGCTGATGATGGTACTA 59.306 52.381 0.00 0.00 0.00 1.82
2746 2768 4.226427 AGGCTAATGTTTCTGATCAGCA 57.774 40.909 18.36 10.72 0.00 4.41
2751 2773 5.235186 GCTAATGTTTCTGATCAGCATACGT 59.765 40.000 18.36 12.89 0.00 3.57
2768 2790 1.145759 CGTACGATGTTGGCTCGCAT 61.146 55.000 10.44 0.00 39.71 4.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
93 94 3.057019 TGCAAGTACAACTAGCAAGACG 58.943 45.455 0.00 0.0 31.42 4.18
287 289 5.691305 GTCACATGCACAACAAAACACATAT 59.309 36.000 0.00 0.0 0.00 1.78
395 397 3.876309 AACAACATCAGTACCACCCTT 57.124 42.857 0.00 0.0 0.00 3.95
747 754 0.037326 GCTTGACCGGACTCATGACA 60.037 55.000 9.46 0.0 0.00 3.58
805 812 2.621526 GTTCAATTTCCGTTGGTCACCT 59.378 45.455 0.00 0.0 0.00 4.00
1075 1083 2.915659 AGAACGGCCACCACGAGA 60.916 61.111 2.24 0.0 34.93 4.04
1125 1133 4.402474 TCCGATCTTAACTTCATCAGAGCA 59.598 41.667 0.00 0.0 0.00 4.26
1288 1296 0.321653 GAAACACGTGGGGCAGATCT 60.322 55.000 21.57 0.0 0.00 2.75
1299 1307 0.034059 CTGCCTCTCTGGAAACACGT 59.966 55.000 0.00 0.0 38.35 4.49
1374 1382 4.530875 CCCTTCTAAGCTCATCAACCATT 58.469 43.478 0.00 0.0 0.00 3.16
1933 1949 6.544564 TGAGTTTTCCACTACAAACTAAAGGG 59.455 38.462 0.00 0.0 42.15 3.95
1939 1955 5.823045 CCTCTTGAGTTTTCCACTACAAACT 59.177 40.000 0.00 0.0 44.26 2.66
1993 2011 0.033503 TGACGGCATCTCCAGGACTA 60.034 55.000 0.00 0.0 34.01 2.59
2018 2036 4.261614 GGCAAAGATGAAAACTTCGGAACT 60.262 41.667 0.00 0.0 0.00 3.01
2037 2055 1.198094 TCCCTCAACTCATCGGGCAA 61.198 55.000 0.00 0.0 36.61 4.52
2099 2120 3.861840 TCTGTGAAGCACTAGCATTACC 58.138 45.455 0.00 0.0 45.49 2.85
2275 2296 5.410924 TCAATGTAGTCAACAGATTCCTCG 58.589 41.667 0.00 0.0 42.70 4.63
2328 2349 1.378882 TAGATTAGCGGCACCGTCGT 61.379 55.000 11.27 0.0 42.09 4.34
2512 2533 4.095185 TCATTCGTTTCGTGGTCAAAAACT 59.905 37.500 0.00 0.0 32.11 2.66
2724 2746 4.592942 TGCTGATCAGAAACATTAGCCTT 58.407 39.130 27.04 0.0 33.05 4.35
2746 2768 1.862815 GCGAGCCAACATCGTACGTAT 60.863 52.381 16.05 4.8 42.13 3.06
2751 2773 0.174617 TGATGCGAGCCAACATCGTA 59.825 50.000 6.11 0.0 44.57 3.43
2768 2790 4.285775 TGACTCACATCAACAATAGGGTGA 59.714 41.667 0.00 0.0 34.46 4.02
2829 2851 9.268268 CAGGAAGTTCAACTACAATACTAACAA 57.732 33.333 5.01 0.0 0.00 2.83
2833 2855 9.256228 AGATCAGGAAGTTCAACTACAATACTA 57.744 33.333 5.01 0.0 0.00 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.