Multiple sequence alignment - TraesCS5A01G036800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G036800 chr5A 100.000 2661 0 0 1 2661 33908464 33911124 0.000000e+00 4915
1 TraesCS5A01G036800 chr5A 96.849 2666 77 7 1 2661 524679155 524681818 0.000000e+00 4451
2 TraesCS5A01G036800 chr5A 95.086 2666 118 11 1 2661 169180631 169177974 0.000000e+00 4185
3 TraesCS5A01G036800 chr5A 94.936 2666 96 18 1 2661 398478064 398475433 0.000000e+00 4139
4 TraesCS5A01G036800 chr1A 96.698 2665 84 4 1 2661 365634836 365637500 0.000000e+00 4431
5 TraesCS5A01G036800 chr1A 95.833 2664 103 8 1 2661 10685399 10688057 0.000000e+00 4298
6 TraesCS5A01G036800 chr3A 95.951 2667 100 7 1 2661 711574759 711572095 0.000000e+00 4320
7 TraesCS5A01G036800 chr3A 94.948 2672 112 18 1 2661 32208573 32211232 0.000000e+00 4165
8 TraesCS5A01G036800 chr7A 95.983 2664 97 8 1 2661 675353866 675351210 0.000000e+00 4318
9 TraesCS5A01G036800 chr4A 95.696 2672 101 13 1 2661 37332167 37334835 0.000000e+00 4285
10 TraesCS5A01G036800 chr6A 96.685 362 12 0 2300 2661 184600582 184600221 1.050000e-168 603


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G036800 chr5A 33908464 33911124 2660 False 4915 4915 100.000 1 2661 1 chr5A.!!$F1 2660
1 TraesCS5A01G036800 chr5A 524679155 524681818 2663 False 4451 4451 96.849 1 2661 1 chr5A.!!$F2 2660
2 TraesCS5A01G036800 chr5A 169177974 169180631 2657 True 4185 4185 95.086 1 2661 1 chr5A.!!$R1 2660
3 TraesCS5A01G036800 chr5A 398475433 398478064 2631 True 4139 4139 94.936 1 2661 1 chr5A.!!$R2 2660
4 TraesCS5A01G036800 chr1A 365634836 365637500 2664 False 4431 4431 96.698 1 2661 1 chr1A.!!$F2 2660
5 TraesCS5A01G036800 chr1A 10685399 10688057 2658 False 4298 4298 95.833 1 2661 1 chr1A.!!$F1 2660
6 TraesCS5A01G036800 chr3A 711572095 711574759 2664 True 4320 4320 95.951 1 2661 1 chr3A.!!$R1 2660
7 TraesCS5A01G036800 chr3A 32208573 32211232 2659 False 4165 4165 94.948 1 2661 1 chr3A.!!$F1 2660
8 TraesCS5A01G036800 chr7A 675351210 675353866 2656 True 4318 4318 95.983 1 2661 1 chr7A.!!$R1 2660
9 TraesCS5A01G036800 chr4A 37332167 37334835 2668 False 4285 4285 95.696 1 2661 1 chr4A.!!$F1 2660

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
838 841 1.541233 GGGCTCATCGTCCAGGTAATG 60.541 57.143 0.0 0.0 37.34 1.9 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2572 2601 0.034756 TACTGAAGCAGCTCGGCAAA 59.965 50.0 0.0 0.0 34.37 3.68 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 3.689347 TGGTGCTGATGTATTTGAGCTT 58.311 40.909 0.00 0.00 32.41 3.74
323 325 6.814146 GGGAGAGGAACATGATATACGATTTC 59.186 42.308 0.00 0.00 0.00 2.17
574 577 8.362464 TGATCTAACTAGGTGTGTAACTTCAT 57.638 34.615 0.00 0.00 38.04 2.57
838 841 1.541233 GGGCTCATCGTCCAGGTAATG 60.541 57.143 0.00 0.00 37.34 1.90
1082 1086 0.911769 CCAATGGACCTACAGGCAGA 59.088 55.000 0.00 0.00 39.32 4.26
1124 1128 3.949842 GGTTAGTACCTTCACCGACTT 57.050 47.619 0.00 0.00 41.53 3.01
1266 1270 5.798125 TGTTTTTCATGTTCTGCCCATAA 57.202 34.783 0.00 0.00 0.00 1.90
1308 1312 2.443416 TGACAGGTCGTGCTACTGTAT 58.557 47.619 0.00 0.00 44.79 2.29
1505 1510 5.204409 TGCACAAGCTTCTGATGATTTTT 57.796 34.783 5.84 0.00 42.74 1.94
1577 1582 0.739813 GTACAAATCGGCGCTGGAGT 60.740 55.000 17.88 12.09 0.00 3.85
2101 2121 3.640029 CCCAATCATATGCCAGCTTCTTT 59.360 43.478 0.00 0.00 0.00 2.52
2196 2216 2.482721 CGAACAACCCACACTCATTACC 59.517 50.000 0.00 0.00 0.00 2.85
2378 2406 0.883833 GCCACTGTGCAACTGCTTAT 59.116 50.000 1.29 0.00 39.67 1.73
2438 2466 9.342308 CAACTGGCTAGATAATCCATTAGAAAA 57.658 33.333 3.17 0.00 0.00 2.29
2572 2601 6.073314 AGGAATGCCATGCTTATTGTCTTAT 58.927 36.000 0.00 0.00 36.29 1.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
24 25 4.038642 GCAACAAATTCCTGGTTTGGTCTA 59.961 41.667 12.67 0.00 40.08 2.59
343 345 1.002430 GTGCTGGATCAGAACCACTCA 59.998 52.381 0.00 0.00 34.10 3.41
594 597 2.874052 GCTACCATGGTGTGTGCAACTA 60.874 50.000 28.17 1.75 38.04 2.24
838 841 4.048470 GGGAGTTGGGGGCAGGTC 62.048 72.222 0.00 0.00 0.00 3.85
900 903 3.521937 AGGTAGCCTATTTGGTGCAACTA 59.478 43.478 2.04 0.00 38.35 2.24
1082 1086 1.566298 GGTGATGAGCCCCCTGAGTT 61.566 60.000 0.00 0.00 0.00 3.01
1124 1128 5.946972 TCACTCACCCTAGTTTTTGTTTTGA 59.053 36.000 0.00 0.00 0.00 2.69
1266 1270 2.829720 TGGTACTTGGATTGTAGTCGCT 59.170 45.455 0.00 0.00 0.00 4.93
1577 1582 7.065204 GCATTTGTTTTTCTTCTTTGGGTGTAA 59.935 33.333 0.00 0.00 0.00 2.41
1715 1725 3.525609 TCCACTTGGTCCCAATATTGCTA 59.474 43.478 10.11 0.00 35.20 3.49
1722 1732 0.850100 TGTGTCCACTTGGTCCCAAT 59.150 50.000 0.00 0.00 35.20 3.16
2101 2121 4.020218 CCCAAGGAAGTACTCAACATCAGA 60.020 45.833 0.00 0.00 0.00 3.27
2235 2259 7.144722 CACAGAGTGCATTACCTTTATTTGA 57.855 36.000 0.00 0.00 0.00 2.69
2378 2406 0.180171 AGTAGTTGCACACTGGCACA 59.820 50.000 10.59 0.00 44.86 4.57
2456 2484 8.865420 AAGACACAGTACTAGTCTTCAATCTA 57.135 34.615 25.66 0.00 46.47 1.98
2572 2601 0.034756 TACTGAAGCAGCTCGGCAAA 59.965 50.000 0.00 0.00 34.37 3.68


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.