Multiple sequence alignment - TraesCS5A01G021200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G021200 chr5A 100.000 3227 0 0 1 3227 17471136 17467910 0 5960
1 TraesCS5A01G021200 chr5A 98.700 3232 36 4 1 3227 9631960 9628730 0 5731
2 TraesCS5A01G021200 chr2A 98.700 3231 38 2 1 3227 389203671 389206901 0 5731
3 TraesCS5A01G021200 chr4B 98.577 3233 40 3 1 3227 14706110 14709342 0 5710
4 TraesCS5A01G021200 chr2B 98.514 3230 45 1 1 3227 608454342 608457571 0 5696
5 TraesCS5A01G021200 chr2B 98.515 3232 37 7 1 3227 99571094 99567869 0 5692
6 TraesCS5A01G021200 chr2B 98.391 3232 42 5 1 3227 741915599 741912373 0 5672


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G021200 chr5A 17467910 17471136 3226 True 5960 5960 100.000 1 3227 1 chr5A.!!$R2 3226
1 TraesCS5A01G021200 chr5A 9628730 9631960 3230 True 5731 5731 98.700 1 3227 1 chr5A.!!$R1 3226
2 TraesCS5A01G021200 chr2A 389203671 389206901 3230 False 5731 5731 98.700 1 3227 1 chr2A.!!$F1 3226
3 TraesCS5A01G021200 chr4B 14706110 14709342 3232 False 5710 5710 98.577 1 3227 1 chr4B.!!$F1 3226
4 TraesCS5A01G021200 chr2B 608454342 608457571 3229 False 5696 5696 98.514 1 3227 1 chr2B.!!$F1 3226
5 TraesCS5A01G021200 chr2B 99567869 99571094 3225 True 5692 5692 98.515 1 3227 1 chr2B.!!$R1 3226
6 TraesCS5A01G021200 chr2B 741912373 741915599 3226 True 5672 5672 98.391 1 3227 1 chr2B.!!$R2 3226

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
428 430 3.311322 TCTGTAGTGCAACAGGAAAAACG 59.689 43.478 16.57 0.0 45.69 3.6 F
1062 1068 4.548451 TCCTCATGATATGGATCAGCAC 57.452 45.455 0.00 0.0 45.29 4.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1837 1846 3.205338 TGCAGTTATACAAGATGCGCAT 58.795 40.909 25.66 25.66 39.74 4.73 R
2984 2999 2.640332 GACTGGAGGAAGGGAAAGAACT 59.360 50.000 0.00 0.00 0.00 3.01 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
226 227 7.659390 GCAACTAAGACATCTATTCTAGCCAAT 59.341 37.037 0.00 0.0 0.00 3.16
384 386 4.459337 GGAAATCCTGGAAATTGAGACGTT 59.541 41.667 0.00 0.0 0.00 3.99
428 430 3.311322 TCTGTAGTGCAACAGGAAAAACG 59.689 43.478 16.57 0.0 45.69 3.60
1062 1068 4.548451 TCCTCATGATATGGATCAGCAC 57.452 45.455 0.00 0.0 45.29 4.40
1837 1846 6.433847 TCTCACCTGATGAAAAGGAGTTTA 57.566 37.500 0.00 0.0 36.69 2.01
1870 1879 8.094548 TCTTGTATAACTGCAACTTGACTACAT 58.905 33.333 0.00 0.0 0.00 2.29
1991 2000 1.473258 TGCAACTGCTGTCCAACTTT 58.527 45.000 2.95 0.0 42.66 2.66
2984 2999 1.332375 GCCGTGCTACTTCAAACACAA 59.668 47.619 0.00 0.0 33.23 3.33
3041 3056 2.027625 GGTTCAACGCCGTCCTCAG 61.028 63.158 0.00 0.0 0.00 3.35
3138 3153 3.640029 CCAAGGAAGGCTGCAATGATTAT 59.360 43.478 0.50 0.0 0.00 1.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
226 227 6.990798 TCAGTTGGACAATTAATGCATTCAA 58.009 32.000 16.86 9.19 0.00 2.69
239 240 2.957680 ACATGCATGTTCAGTTGGACAA 59.042 40.909 26.61 0.00 37.90 3.18
384 386 7.974675 CAGATTTCTGGTTTTCGCTAGAATAA 58.025 34.615 0.00 0.00 40.20 1.40
428 430 3.421844 AGCCATGGACAAAAGTTCCTAC 58.578 45.455 18.40 0.00 33.84 3.18
601 603 5.565509 AGAAGAAAGAAGAATTGGAGGACC 58.434 41.667 0.00 0.00 0.00 4.46
1062 1068 1.545582 CCTTGTTGTATGCTGGGTTGG 59.454 52.381 0.00 0.00 0.00 3.77
1193 1199 1.869767 CTGACTGCAAAGACACCACTC 59.130 52.381 0.00 0.00 0.00 3.51
1837 1846 3.205338 TGCAGTTATACAAGATGCGCAT 58.795 40.909 25.66 25.66 39.74 4.73
1870 1879 6.134535 AGGGATATAGAAAAACACCACACA 57.865 37.500 0.00 0.00 0.00 3.72
1991 2000 8.859090 CCCAAAGTGATATATAAAAAGCATGGA 58.141 33.333 0.00 0.00 0.00 3.41
2984 2999 2.640332 GACTGGAGGAAGGGAAAGAACT 59.360 50.000 0.00 0.00 0.00 3.01
3138 3153 4.346709 TCAATCTCAAGGTGTTGTGTCCTA 59.653 41.667 0.00 0.00 34.98 2.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.