Multiple sequence alignment - TraesCS5A01G021100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G021100 chr5A 100.000 2663 0 0 1 2663 17467857 17465195 0 4918
1 TraesCS5A01G021100 chr5A 98.458 2659 38 3 6 2663 294236748 294234092 0 4680
2 TraesCS5A01G021100 chr2B 98.909 2659 27 2 6 2663 608457629 608460286 0 4748
3 TraesCS5A01G021100 chr2B 98.533 2659 38 1 6 2663 99567811 99565153 0 4693
4 TraesCS5A01G021100 chr2A 98.760 2662 28 5 6 2663 389206959 389209619 0 4728
5 TraesCS5A01G021100 chr7B 98.608 2659 36 1 6 2663 194130136 194127478 0 4704
6 TraesCS5A01G021100 chr7B 98.383 2659 42 1 6 2663 666524123 666526781 0 4671
7 TraesCS5A01G021100 chr6A 98.608 2658 36 1 6 2663 87943540 87940884 0 4702
8 TraesCS5A01G021100 chr6A 98.533 2658 39 0 6 2663 480640266 480637609 0 4693
9 TraesCS5A01G021100 chr1A 98.459 2661 38 3 6 2663 255473991 255471331 0 4684


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G021100 chr5A 17465195 17467857 2662 True 4918 4918 100.000 1 2663 1 chr5A.!!$R1 2662
1 TraesCS5A01G021100 chr5A 294234092 294236748 2656 True 4680 4680 98.458 6 2663 1 chr5A.!!$R2 2657
2 TraesCS5A01G021100 chr2B 608457629 608460286 2657 False 4748 4748 98.909 6 2663 1 chr2B.!!$F1 2657
3 TraesCS5A01G021100 chr2B 99565153 99567811 2658 True 4693 4693 98.533 6 2663 1 chr2B.!!$R1 2657
4 TraesCS5A01G021100 chr2A 389206959 389209619 2660 False 4728 4728 98.760 6 2663 1 chr2A.!!$F1 2657
5 TraesCS5A01G021100 chr7B 194127478 194130136 2658 True 4704 4704 98.608 6 2663 1 chr7B.!!$R1 2657
6 TraesCS5A01G021100 chr7B 666524123 666526781 2658 False 4671 4671 98.383 6 2663 1 chr7B.!!$F1 2657
7 TraesCS5A01G021100 chr6A 87940884 87943540 2656 True 4702 4702 98.608 6 2663 1 chr6A.!!$R1 2657
8 TraesCS5A01G021100 chr6A 480637609 480640266 2657 True 4693 4693 98.533 6 2663 1 chr6A.!!$R2 2657
9 TraesCS5A01G021100 chr1A 255471331 255473991 2660 True 4684 4684 98.459 6 2663 1 chr1A.!!$R1 2657

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
355 356 0.684535 TGCGAGTGGTTCTGATCCAA 59.315 50.0 8.97 0.0 36.68 3.53 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2324 2333 0.316204 AGTGGCGCGTAAGTAGTTGT 59.684 50.0 8.43 0.0 41.68 3.32 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
205 206 2.434702 CCGGAAAGGTACCTGCTAAGAT 59.565 50.000 17.14 0.0 34.51 2.40
314 315 3.511934 AGGGAGAGGAACATGATATACGC 59.488 47.826 0.00 0.0 0.00 4.42
355 356 0.684535 TGCGAGTGGTTCTGATCCAA 59.315 50.000 8.97 0.0 36.68 3.53
632 634 4.286032 AGCCACTTGGACAAGAACATACTA 59.714 41.667 18.15 0.0 40.79 1.82
870 872 4.348020 ACTCCCCATCAAACTAGGTCTA 57.652 45.455 0.00 0.0 0.00 2.59
1203 1206 2.816087 CAGAAACATGCTGCCTAGTTGT 59.184 45.455 0.00 0.0 0.00 3.32
2089 2095 1.490490 ACGCTGGTGACCCAATCATAT 59.510 47.619 0.00 0.0 41.27 1.78
2130 2136 1.622312 GAGTACTTCCTTGGGGTCGTT 59.378 52.381 0.00 0.0 0.00 3.85
2288 2297 5.995565 ACTTATGTCCTACTGTGCAACTA 57.004 39.130 0.00 0.0 38.04 2.24
2324 2333 4.764308 TGCAACTCATTATGTGCCACTTTA 59.236 37.500 0.00 0.0 0.00 1.85
2545 2556 9.093970 CTTTGGTACGTCAATGTCAATAATCTA 57.906 33.333 0.00 0.0 0.00 1.98
2644 2655 3.753815 TCATCAGCTCAATGTTGTCCAA 58.246 40.909 5.70 0.0 0.00 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 4.394920 GGTCCGAGCTCAAAAACATATGAA 59.605 41.667 15.40 0.00 0.00 2.57
1 2 3.938963 GGTCCGAGCTCAAAAACATATGA 59.061 43.478 15.40 0.00 0.00 2.15
2 3 3.242413 CGGTCCGAGCTCAAAAACATATG 60.242 47.826 15.40 0.00 0.00 1.78
3 4 2.936498 CGGTCCGAGCTCAAAAACATAT 59.064 45.455 15.40 0.00 0.00 1.78
4 5 2.028839 TCGGTCCGAGCTCAAAAACATA 60.029 45.455 10.71 0.00 0.00 2.29
9 10 0.601841 GGTTCGGTCCGAGCTCAAAA 60.602 55.000 24.85 1.69 37.27 2.44
19 20 1.905637 ACAAATTCCTGGTTCGGTCC 58.094 50.000 0.00 0.00 0.00 4.46
223 224 1.075525 TCCCTGGCGCACTAGGTAT 60.076 57.895 19.15 0.00 31.99 2.73
355 356 8.777413 CATATGCTTGTATACAATAGCTTGTGT 58.223 33.333 23.46 4.43 45.16 3.72
632 634 2.738521 CAGCGTGCGCAACTAGGT 60.739 61.111 14.00 7.01 44.88 3.08
778 780 1.076559 CCATTGGGAGGAGCATGCA 60.077 57.895 21.98 0.00 35.59 3.96
870 872 5.163488 CCATGATGTGTGCAATTGGAGTTAT 60.163 40.000 7.72 0.00 0.00 1.89
1203 1206 1.597195 CTCAAACTAACACAGCGCACA 59.403 47.619 11.47 0.00 0.00 4.57
2089 2095 3.071457 TCAACATCAGGAAGAAGCTGACA 59.929 43.478 0.00 0.00 0.00 3.58
2130 2136 1.228429 GGTAGCCAACTGCCCAACA 60.228 57.895 0.00 0.00 42.54 3.33
2288 2297 4.137116 TGAGTTGCAGTAGAACACAAGT 57.863 40.909 0.00 0.00 0.00 3.16
2324 2333 0.316204 AGTGGCGCGTAAGTAGTTGT 59.684 50.000 8.43 0.00 41.68 3.32


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.