Multiple sequence alignment - TraesCS5A01G020600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G020600 chr5A 100.000 2528 0 0 1 2528 16623272 16620745 0 4669
1 TraesCS5A01G020600 chr5A 98.693 2524 30 2 3 2526 300048570 300051090 0 4475
2 TraesCS5A01G020600 chr7B 99.129 2526 20 2 3 2528 743066310 743068833 0 4542
3 TraesCS5A01G020600 chr2A 99.049 2524 22 2 3 2526 735172804 735175325 0 4527
4 TraesCS5A01G020600 chr7A 98.812 2526 26 3 3 2528 671960563 671958042 0 4495
5 TraesCS5A01G020600 chr7A 98.812 2526 23 4 3 2528 120828843 120826325 0 4492
6 TraesCS5A01G020600 chr3B 98.694 2526 26 5 3 2528 201635798 201633280 0 4475
7 TraesCS5A01G020600 chr2D 98.615 2527 29 4 3 2528 635037265 635039786 0 4468
8 TraesCS5A01G020600 chr5B 98.614 2526 30 4 3 2528 713046206 713043686 0 4466
9 TraesCS5A01G020600 chr4D 98.575 2526 33 3 3 2528 123367647 123370169 0 4462


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G020600 chr5A 16620745 16623272 2527 True 4669 4669 100.000 1 2528 1 chr5A.!!$R1 2527
1 TraesCS5A01G020600 chr5A 300048570 300051090 2520 False 4475 4475 98.693 3 2526 1 chr5A.!!$F1 2523
2 TraesCS5A01G020600 chr7B 743066310 743068833 2523 False 4542 4542 99.129 3 2528 1 chr7B.!!$F1 2525
3 TraesCS5A01G020600 chr2A 735172804 735175325 2521 False 4527 4527 99.049 3 2526 1 chr2A.!!$F1 2523
4 TraesCS5A01G020600 chr7A 671958042 671960563 2521 True 4495 4495 98.812 3 2528 1 chr7A.!!$R2 2525
5 TraesCS5A01G020600 chr7A 120826325 120828843 2518 True 4492 4492 98.812 3 2528 1 chr7A.!!$R1 2525
6 TraesCS5A01G020600 chr3B 201633280 201635798 2518 True 4475 4475 98.694 3 2528 1 chr3B.!!$R1 2525
7 TraesCS5A01G020600 chr2D 635037265 635039786 2521 False 4468 4468 98.615 3 2528 1 chr2D.!!$F1 2525
8 TraesCS5A01G020600 chr5B 713043686 713046206 2520 True 4466 4466 98.614 3 2528 1 chr5B.!!$R1 2525
9 TraesCS5A01G020600 chr4D 123367647 123370169 2522 False 4462 4462 98.575 3 2528 1 chr4D.!!$F1 2525

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
162 163 2.761213 CCTTTCATGGCTGCCCCC 60.761 66.667 17.53 0.0 0.0 5.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1771 1778 0.855349 CGAGGAATTCATTCTCGCGG 59.145 55.0 16.22 0.0 37.0 6.46 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
162 163 2.761213 CCTTTCATGGCTGCCCCC 60.761 66.667 17.53 0.0 0.00 5.40
314 315 4.600062 TCAGATAGGTGCTCAACTACAGA 58.400 43.478 0.00 0.0 32.71 3.41
441 442 7.394641 CACTACTAGATAGATTGTATGGCTCCA 59.605 40.741 0.00 0.0 34.65 3.86
1189 1196 5.562307 CGGATACAATTCGATCCTTCTACGT 60.562 44.000 11.62 0.0 39.69 3.57
1771 1778 1.134037 TGTGTAGGGGGTGTGTTTGTC 60.134 52.381 0.00 0.0 0.00 3.18
1874 1882 5.494390 AATAAAGGAAACTGTACCCGACT 57.506 39.130 0.00 0.0 42.68 4.18
2140 2149 3.541713 CGGGCAGGGTAGAGCTCC 61.542 72.222 10.93 0.0 0.00 4.70
2238 2247 1.375013 GAAGCGGGCCTAAACGACA 60.375 57.895 0.84 0.0 0.00 4.35
2342 2351 5.994250 ACAAGCATAGTGGTCTAATGACAT 58.006 37.500 0.00 0.0 44.61 3.06
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
162 163 0.817634 TGCAAAGTGAACTGACCGGG 60.818 55.000 6.32 0.0 0.00 5.73
244 245 4.386049 CACGCAACTCTAAAGAAGACGATT 59.614 41.667 0.00 0.0 0.00 3.34
314 315 7.728981 TCTCGTCTCCCCATAAAATAGATAAGT 59.271 37.037 0.00 0.0 0.00 2.24
441 442 2.002586 CGCGATCAGAAAGTCACCAAT 58.997 47.619 0.00 0.0 0.00 3.16
1771 1778 0.855349 CGAGGAATTCATTCTCGCGG 59.145 55.000 16.22 0.0 37.00 6.46
1874 1882 2.726821 ACGAGTTTACGTCCATCCCTA 58.273 47.619 0.00 0.0 43.02 3.53
2140 2149 1.269309 CCTATTCTCGAACCCTCTGCG 60.269 57.143 0.00 0.0 0.00 5.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.