Multiple sequence alignment - TraesCS5A01G020500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G020500 chr5A 100.000 2317 0 0 1 2317 16602920 16600604 0 4279
1 TraesCS5A01G020500 chr5A 99.181 2321 15 2 1 2317 300072978 300075298 0 4178
2 TraesCS5A01G020500 chr2A 99.095 2321 17 2 1 2317 618279957 618277637 0 4167
3 TraesCS5A01G020500 chr6A 99.008 2319 21 2 1 2317 289128631 289130949 0 4154
4 TraesCS5A01G020500 chrUn 98.966 2321 20 2 1 2317 189392538 189394858 0 4150
5 TraesCS5A01G020500 chr7B 98.966 2321 20 3 1 2317 743086198 743088518 0 4150
6 TraesCS5A01G020500 chr7D 98.794 2321 24 2 1 2317 626698491 626696171 0 4128
7 TraesCS5A01G020500 chr7D 98.664 2320 28 2 1 2317 203556346 203554027 0 4109
8 TraesCS5A01G020500 chr3B 98.664 2320 26 4 1 2317 92199603 92201920 0 4108
9 TraesCS5A01G020500 chr7A 98.581 2325 25 3 1 2317 4959837 4962161 0 4104


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G020500 chr5A 16600604 16602920 2316 True 4279 4279 100.000 1 2317 1 chr5A.!!$R1 2316
1 TraesCS5A01G020500 chr5A 300072978 300075298 2320 False 4178 4178 99.181 1 2317 1 chr5A.!!$F1 2316
2 TraesCS5A01G020500 chr2A 618277637 618279957 2320 True 4167 4167 99.095 1 2317 1 chr2A.!!$R1 2316
3 TraesCS5A01G020500 chr6A 289128631 289130949 2318 False 4154 4154 99.008 1 2317 1 chr6A.!!$F1 2316
4 TraesCS5A01G020500 chrUn 189392538 189394858 2320 False 4150 4150 98.966 1 2317 1 chrUn.!!$F1 2316
5 TraesCS5A01G020500 chr7B 743086198 743088518 2320 False 4150 4150 98.966 1 2317 1 chr7B.!!$F1 2316
6 TraesCS5A01G020500 chr7D 626696171 626698491 2320 True 4128 4128 98.794 1 2317 1 chr7D.!!$R2 2316
7 TraesCS5A01G020500 chr7D 203554027 203556346 2319 True 4109 4109 98.664 1 2317 1 chr7D.!!$R1 2316
8 TraesCS5A01G020500 chr3B 92199603 92201920 2317 False 4108 4108 98.664 1 2317 1 chr3B.!!$F1 2316
9 TraesCS5A01G020500 chr7A 4959837 4962161 2324 False 4104 4104 98.581 1 2317 1 chr7A.!!$F1 2316

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
601 606 2.418669 TCCAAACCCAAACTCTCCTCT 58.581 47.619 0.0 0.0 0.0 3.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2056 2071 0.603707 CACCGGCAAGAAGCTTCTCA 60.604 55.0 28.58 0.0 44.79 3.27 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
236 237 4.319984 CGAGGGTCAATATGTGCATTCATG 60.320 45.833 0.00 0.0 0.00 3.07
239 240 4.338964 GGGTCAATATGTGCATTCATGTCA 59.661 41.667 0.00 0.0 0.00 3.58
378 379 6.127842 ACAAAAGAAGAAAAAGAAGCCGTACA 60.128 34.615 0.00 0.0 0.00 2.90
428 429 3.198872 GCTATAGACTCAAAGGGCACAC 58.801 50.000 3.21 0.0 0.00 3.82
601 606 2.418669 TCCAAACCCAAACTCTCCTCT 58.581 47.619 0.00 0.0 0.00 3.69
867 872 4.453480 TTCACATCAGAACCCTTTCCTT 57.547 40.909 0.00 0.0 31.28 3.36
1027 1033 4.998672 TGATTGTACCGAACGAAGGATTTT 59.001 37.500 0.00 0.0 0.00 1.82
1412 1422 5.129320 TCTGAAAGTGAATAGGAGCATAGCA 59.871 40.000 0.00 0.0 33.76 3.49
1845 1860 2.824936 TCCAAATCATTTGCCGACATGT 59.175 40.909 4.40 0.0 39.31 3.21
1923 1938 5.067283 GTGGGTGAATCAAGTACAACAAGTT 59.933 40.000 0.00 0.0 0.00 2.66
2056 2071 1.203187 TCAAGTCAGAGTAGGGTGGCT 60.203 52.381 0.00 0.0 0.00 4.75
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
236 237 3.184581 GTCATTGTCGTTTCCTGACTGAC 59.815 47.826 0.00 1.46 35.65 3.51
239 240 3.322254 AGAGTCATTGTCGTTTCCTGACT 59.678 43.478 3.35 3.35 46.78 3.41
428 429 1.609208 AAAAGTACCAGCAGCCTGTG 58.391 50.000 0.00 0.00 37.38 3.66
601 606 6.101150 AGGCACTGTCTATATATCCAAAACCA 59.899 38.462 0.00 0.00 37.18 3.67
867 872 2.025699 CCGATGGGTAAAAAGGGGAAGA 60.026 50.000 0.00 0.00 0.00 2.87
1027 1033 3.627395 ATGTGGCTTTCGTGATAAGGA 57.373 42.857 0.00 0.00 0.00 3.36
1412 1422 1.547372 GTGTTTGGCTTGGATGATGCT 59.453 47.619 0.00 0.00 0.00 3.79
1845 1860 4.844085 TCCCATAAAAGAGAAGTGAGTCCA 59.156 41.667 0.00 0.00 0.00 4.02
1923 1938 3.451402 TCTACCACAAGCTCTGACCTA 57.549 47.619 0.00 0.00 0.00 3.08
2056 2071 0.603707 CACCGGCAAGAAGCTTCTCA 60.604 55.000 28.58 0.00 44.79 3.27


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.