Multiple sequence alignment - TraesCS5A01G020400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G020400 chr5A 100.000 2723 0 0 1 2723 16601427 16598705 0 5029
1 TraesCS5A01G020400 chr5B 99.339 2723 18 0 1 2723 679660393 679663115 0 4929
2 TraesCS5A01G020400 chrUn 99.303 2725 17 2 1 2723 189394035 189396759 0 4926
3 TraesCS5A01G020400 chr7B 99.302 2723 19 0 1 2723 743087695 743090417 0 4924
4 TraesCS5A01G020400 chr7D 99.192 2724 20 2 2 2723 203554849 203552126 0 4907
5 TraesCS5A01G020400 chr6A 99.155 2723 23 0 1 2723 289130126 289132848 0 4902
6 TraesCS5A01G020400 chr4D 99.008 2723 25 1 1 2723 123414378 123417098 0 4878
7 TraesCS5A01G020400 chr4A 98.204 2729 43 2 1 2723 67586039 67583311 0 4763


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G020400 chr5A 16598705 16601427 2722 True 5029 5029 100.000 1 2723 1 chr5A.!!$R1 2722
1 TraesCS5A01G020400 chr5B 679660393 679663115 2722 False 4929 4929 99.339 1 2723 1 chr5B.!!$F1 2722
2 TraesCS5A01G020400 chrUn 189394035 189396759 2724 False 4926 4926 99.303 1 2723 1 chrUn.!!$F1 2722
3 TraesCS5A01G020400 chr7B 743087695 743090417 2722 False 4924 4924 99.302 1 2723 1 chr7B.!!$F1 2722
4 TraesCS5A01G020400 chr7D 203552126 203554849 2723 True 4907 4907 99.192 2 2723 1 chr7D.!!$R1 2721
5 TraesCS5A01G020400 chr6A 289130126 289132848 2722 False 4902 4902 99.155 1 2723 1 chr6A.!!$F1 2722
6 TraesCS5A01G020400 chr4D 123414378 123417098 2720 False 4878 4878 99.008 1 2723 1 chr4D.!!$F1 2722
7 TraesCS5A01G020400 chr4A 67583311 67586039 2728 True 4763 4763 98.204 1 2723 1 chr4A.!!$R1 2722

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
563 569 1.203187 TCAAGTCAGAGTAGGGTGGCT 60.203 52.381 0.0 0.0 0.0 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2511 2520 1.406069 CCTCAATGAACCAGACCTCGG 60.406 57.143 0.0 0.0 0.0 4.63 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
352 358 2.824936 TCCAAATCATTTGCCGACATGT 59.175 40.909 4.40 0.00 39.31 3.21
430 436 5.067283 GTGGGTGAATCAAGTACAACAAGTT 59.933 40.000 0.00 0.00 0.00 2.66
563 569 1.203187 TCAAGTCAGAGTAGGGTGGCT 60.203 52.381 0.00 0.00 0.00 4.75
1075 1082 3.488047 CGCGCAAATTCTCATTGGATCTT 60.488 43.478 8.75 0.00 0.00 2.40
1420 1428 3.561313 CCTTATTTACCTGGGTGCACTGT 60.561 47.826 17.98 11.36 0.00 3.55
2314 2323 9.573166 TCAGTCTTTTTCCTTTCTTTGATGATA 57.427 29.630 0.00 0.00 0.00 2.15
2511 2520 1.330829 GCGAAGGGATGAACGAATTCC 59.669 52.381 0.00 0.00 33.49 3.01
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
352 358 4.844085 TCCCATAAAAGAGAAGTGAGTCCA 59.156 41.667 0.00 0.0 0.00 4.02
430 436 3.451402 TCTACCACAAGCTCTGACCTA 57.549 47.619 0.00 0.0 0.00 3.08
563 569 0.603707 CACCGGCAAGAAGCTTCTCA 60.604 55.000 28.58 0.0 44.79 3.27
1075 1082 2.811431 CCATCGCTGTTAAGAACAACCA 59.189 45.455 0.00 0.0 41.61 3.67
1420 1428 3.692101 TCGACAGGAAGCTTTTGAAAACA 59.308 39.130 16.11 0.0 0.00 2.83
2314 2323 7.069085 CAGGGAATTCAAATAGATGTGTGGAAT 59.931 37.037 7.93 0.0 0.00 3.01
2511 2520 1.406069 CCTCAATGAACCAGACCTCGG 60.406 57.143 0.00 0.0 0.00 4.63


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.