Multiple sequence alignment - TraesCS5A01G020300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G020300 chr5A 100.000 2357 0 0 1 2357 16577919 16575563 0 4353
1 TraesCS5A01G020300 chr1A 99.406 2357 14 0 1 2357 238109744 238107388 0 4276
2 TraesCS5A01G020300 chr1A 99.321 2357 16 0 1 2357 238155129 238152773 0 4265
3 TraesCS5A01G020300 chr7A 99.067 2357 22 0 1 2357 60329009 60326653 0 4231
4 TraesCS5A01G020300 chr7D 98.982 2357 21 1 1 2357 579015579 579017932 0 4217
5 TraesCS5A01G020300 chr6B 98.897 2357 22 2 1 2357 596657305 596654953 0 4205
6 TraesCS5A01G020300 chrUn 98.897 2357 20 2 1 2357 237257829 237255479 0 4204
7 TraesCS5A01G020300 chr1B 98.727 2357 28 2 1 2357 672508549 672506195 0 4185


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G020300 chr5A 16575563 16577919 2356 True 4353 4353 100.000 1 2357 1 chr5A.!!$R1 2356
1 TraesCS5A01G020300 chr1A 238107388 238109744 2356 True 4276 4276 99.406 1 2357 1 chr1A.!!$R1 2356
2 TraesCS5A01G020300 chr1A 238152773 238155129 2356 True 4265 4265 99.321 1 2357 1 chr1A.!!$R2 2356
3 TraesCS5A01G020300 chr7A 60326653 60329009 2356 True 4231 4231 99.067 1 2357 1 chr7A.!!$R1 2356
4 TraesCS5A01G020300 chr7D 579015579 579017932 2353 False 4217 4217 98.982 1 2357 1 chr7D.!!$F1 2356
5 TraesCS5A01G020300 chr6B 596654953 596657305 2352 True 4205 4205 98.897 1 2357 1 chr6B.!!$R1 2356
6 TraesCS5A01G020300 chrUn 237255479 237257829 2350 True 4204 4204 98.897 1 2357 1 chrUn.!!$R1 2356
7 TraesCS5A01G020300 chr1B 672506195 672508549 2354 True 4185 4185 98.727 1 2357 1 chr1B.!!$R1 2356

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
125 126 6.776887 AGGAGATATTCATTCCATTCAGGT 57.223 37.5 0.0 0.0 39.02 4.0 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1512 1514 1.21087 TTTTTCGGTGTTCTCGTCGG 58.789 50.0 0.0 0.0 0.0 4.79 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
125 126 6.776887 AGGAGATATTCATTCCATTCAGGT 57.223 37.500 0.00 0.0 39.02 4.00
1155 1156 2.502492 CGATCCCTCCGGTGATGCT 61.502 63.158 4.76 0.0 0.00 3.79
1372 1374 4.287845 GGGAGTAACCACTTTAGAAAGGGA 59.712 45.833 5.82 0.0 42.02 4.20
1512 1514 0.108138 AGGAGTATGCCTGCGTGTTC 60.108 55.000 0.00 0.0 36.76 3.18
1718 1720 1.467920 GAGTCAAGGATTTGCTGGGG 58.532 55.000 0.00 0.0 34.21 4.96
1723 1725 2.312741 TCAAGGATTTGCTGGGGATTCT 59.687 45.455 0.00 0.0 34.21 2.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
125 126 3.081409 GCCGCCCTTCCTCACCTA 61.081 66.667 0.0 0.0 0.00 3.08
502 503 2.820479 CGTAATTTCGCCCGCCCA 60.820 61.111 0.0 0.0 0.00 5.36
1512 1514 1.210870 TTTTTCGGTGTTCTCGTCGG 58.789 50.000 0.0 0.0 0.00 4.79
1718 1720 4.939052 TCCCTTTCTACGATCCAGAATC 57.061 45.455 5.5 0.0 32.27 2.52
1723 1725 4.547671 AGATCTTCCCTTTCTACGATCCA 58.452 43.478 0.0 0.0 0.00 3.41


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.