Multiple sequence alignment - TraesCS5A01G020100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G020100 chr5A 100.000 2471 0 0 1 2471 16575815 16573345 0 4564
1 TraesCS5A01G020100 chr1A 99.393 2472 13 2 1 2471 238153025 238150555 0 4481
2 TraesCS5A01G020100 chr1A 99.150 2472 15 3 1 2471 238107640 238105174 0 4444
3 TraesCS5A01G020100 chr6B 98.949 2475 19 2 1 2471 596655205 596652734 0 4420
4 TraesCS5A01G020100 chr3A 98.948 2472 24 2 1 2471 247672882 247675352 0 4420
5 TraesCS5A01G020100 chr4B 98.019 2474 35 3 1 2471 209048960 209051422 0 4285
6 TraesCS5A01G020100 chr2B 98.504 2339 34 1 133 2471 500759802 500757465 0 4124
7 TraesCS5A01G020100 chr2B 97.260 2190 39 6 295 2471 357280906 357278725 0 3692
8 TraesCS5A01G020100 chr2B 98.263 806 12 2 1667 2471 385133107 385132303 0 1410
9 TraesCS5A01G020100 chr7A 99.203 2132 15 2 1 2132 60326905 60324776 0 3842
10 TraesCS5A01G020100 chrUn 97.114 1698 40 4 1 1693 371043359 371041666 0 2856
11 TraesCS5A01G020100 chrUn 97.059 1700 41 4 1 1695 237255731 237254036 0 2854


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G020100 chr5A 16573345 16575815 2470 True 4564 4564 100.000 1 2471 1 chr5A.!!$R1 2470
1 TraesCS5A01G020100 chr1A 238150555 238153025 2470 True 4481 4481 99.393 1 2471 1 chr1A.!!$R2 2470
2 TraesCS5A01G020100 chr1A 238105174 238107640 2466 True 4444 4444 99.150 1 2471 1 chr1A.!!$R1 2470
3 TraesCS5A01G020100 chr6B 596652734 596655205 2471 True 4420 4420 98.949 1 2471 1 chr6B.!!$R1 2470
4 TraesCS5A01G020100 chr3A 247672882 247675352 2470 False 4420 4420 98.948 1 2471 1 chr3A.!!$F1 2470
5 TraesCS5A01G020100 chr4B 209048960 209051422 2462 False 4285 4285 98.019 1 2471 1 chr4B.!!$F1 2470
6 TraesCS5A01G020100 chr2B 500757465 500759802 2337 True 4124 4124 98.504 133 2471 1 chr2B.!!$R3 2338
7 TraesCS5A01G020100 chr2B 357278725 357280906 2181 True 3692 3692 97.260 295 2471 1 chr2B.!!$R1 2176
8 TraesCS5A01G020100 chr2B 385132303 385133107 804 True 1410 1410 98.263 1667 2471 1 chr2B.!!$R2 804
9 TraesCS5A01G020100 chr7A 60324776 60326905 2129 True 3842 3842 99.203 1 2132 1 chr7A.!!$R1 2131
10 TraesCS5A01G020100 chrUn 371041666 371043359 1693 True 2856 2856 97.114 1 1693 1 chrUn.!!$R2 1692
11 TraesCS5A01G020100 chrUn 237254036 237255731 1695 True 2854 2854 97.059 1 1695 1 chrUn.!!$R1 1694

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
832 837 0.472734 CCCGGGGAATCTCCAGATCT 60.473 60.0 14.71 0.0 38.64 2.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2169 2199 4.74931 CAGAGCCAGAGCCGCGTT 62.749 66.667 4.92 0.0 41.25 4.84 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
664 665 1.382695 ATTCTCCCGACCCCGATGT 60.383 57.895 0.00 0.00 38.22 3.06
784 785 4.097892 GCGTAAAAGGTGGGATGATGATTT 59.902 41.667 0.00 0.00 0.00 2.17
832 837 0.472734 CCCGGGGAATCTCCAGATCT 60.473 60.000 14.71 0.00 38.64 2.75
1131 1142 9.798994 GGAATTAGTAGAATTCTCAAACTACGA 57.201 33.333 12.24 1.43 39.75 3.43
1684 1704 2.283388 AGTGGGCATGTGGGCTTG 60.283 61.111 0.00 0.00 42.84 4.01
2048 2077 4.023450 GTGTGTAATCGATATGTCTCCCGA 60.023 45.833 0.00 0.00 35.43 5.14
2169 2199 3.725819 CGAGTTGTTCGTTGCCCA 58.274 55.556 0.00 0.00 44.27 5.36
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
664 665 0.037303 CTCCTGCTCTTCCAAAGGCA 59.963 55.000 0.00 0.0 34.83 4.75
784 785 1.806496 ATCATCATCTTCGGACCCCA 58.194 50.000 0.00 0.0 0.00 4.96
1684 1704 6.539103 AGCGGTATCTTTTCCTCTTTTGATAC 59.461 38.462 0.00 0.0 36.95 2.24
2048 2077 5.825593 TGTGTTGATAGAGGGTTTTCTCT 57.174 39.130 0.00 0.0 45.22 3.10
2169 2199 4.749310 CAGAGCCAGAGCCGCGTT 62.749 66.667 4.92 0.0 41.25 4.84


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.