Multiple sequence alignment - TraesCS5A01G020000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G020000 chr5A 100.000 2342 0 0 1 2342 16544455 16546796 0.000000e+00 4325.0
1 TraesCS5A01G020000 chr5A 98.804 2342 16 1 1 2342 420185603 420187932 0.000000e+00 4159.0
2 TraesCS5A01G020000 chr5A 90.040 251 19 2 2044 2294 327918944 327918700 1.040000e-83 320.0
3 TraesCS5A01G020000 chr7B 99.402 2342 14 0 1 2342 716784508 716786849 0.000000e+00 4248.0
4 TraesCS5A01G020000 chr7B 99.317 2342 16 0 1 2342 742948837 742946496 0.000000e+00 4237.0
5 TraesCS5A01G020000 chr7B 96.274 2308 69 4 38 2342 139608300 139610593 0.000000e+00 3770.0
6 TraesCS5A01G020000 chr7A 99.402 2342 14 0 1 2342 60168866 60166525 0.000000e+00 4248.0
7 TraesCS5A01G020000 chr7A 99.360 2342 15 0 1 2342 60084837 60087178 0.000000e+00 4242.0
8 TraesCS5A01G020000 chr1D 98.198 2331 39 2 1 2329 275778829 275781158 0.000000e+00 4069.0
9 TraesCS5A01G020000 chr6B 97.310 2342 49 3 1 2342 388287136 388284809 0.000000e+00 3964.0
10 TraesCS5A01G020000 chr2D 96.159 2343 68 11 1 2342 291773520 291775841 0.000000e+00 3808.0
11 TraesCS5A01G020000 chr2A 92.308 130 10 0 1970 2099 6317750 6317879 3.970000e-43 185.0
12 TraesCS5A01G020000 chr2A 96.226 53 2 0 2078 2130 341925196 341925248 1.150000e-13 87.9


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G020000 chr5A 16544455 16546796 2341 False 4325 4325 100.000 1 2342 1 chr5A.!!$F1 2341
1 TraesCS5A01G020000 chr5A 420185603 420187932 2329 False 4159 4159 98.804 1 2342 1 chr5A.!!$F2 2341
2 TraesCS5A01G020000 chr7B 716784508 716786849 2341 False 4248 4248 99.402 1 2342 1 chr7B.!!$F2 2341
3 TraesCS5A01G020000 chr7B 742946496 742948837 2341 True 4237 4237 99.317 1 2342 1 chr7B.!!$R1 2341
4 TraesCS5A01G020000 chr7B 139608300 139610593 2293 False 3770 3770 96.274 38 2342 1 chr7B.!!$F1 2304
5 TraesCS5A01G020000 chr7A 60166525 60168866 2341 True 4248 4248 99.402 1 2342 1 chr7A.!!$R1 2341
6 TraesCS5A01G020000 chr7A 60084837 60087178 2341 False 4242 4242 99.360 1 2342 1 chr7A.!!$F1 2341
7 TraesCS5A01G020000 chr1D 275778829 275781158 2329 False 4069 4069 98.198 1 2329 1 chr1D.!!$F1 2328
8 TraesCS5A01G020000 chr6B 388284809 388287136 2327 True 3964 3964 97.310 1 2342 1 chr6B.!!$R1 2341
9 TraesCS5A01G020000 chr2D 291773520 291775841 2321 False 3808 3808 96.159 1 2342 1 chr2D.!!$F1 2341

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
862 863 0.90818 AAGGTTGACGGACCCCCTAG 60.908 60.0 1.8 0.0 40.73 3.02 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2225 2233 9.893634 TTGTATTCCACCGAATAAGAATAAGAA 57.106 29.63 0.0 0.0 41.53 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
844 845 4.232061 CCCACCCAGCCCCACAAA 62.232 66.667 0.0 0.0 0.00 2.83
862 863 0.908180 AAGGTTGACGGACCCCCTAG 60.908 60.000 1.8 0.0 40.73 3.02
2214 2222 2.310052 ACAAAGATAGCCCCTTCTTGCT 59.690 45.455 0.0 0.0 41.57 3.91
2215 2223 2.948315 CAAAGATAGCCCCTTCTTGCTC 59.052 50.000 0.0 0.0 39.00 4.26
2216 2224 2.188818 AGATAGCCCCTTCTTGCTCT 57.811 50.000 0.0 0.0 39.00 4.09
2217 2225 2.486716 AGATAGCCCCTTCTTGCTCTT 58.513 47.619 0.0 0.0 39.00 2.85
2218 2226 3.658725 AGATAGCCCCTTCTTGCTCTTA 58.341 45.455 0.0 0.0 39.00 2.10
2219 2227 4.238669 AGATAGCCCCTTCTTGCTCTTAT 58.761 43.478 0.0 0.0 39.00 1.73
2220 2228 4.662650 AGATAGCCCCTTCTTGCTCTTATT 59.337 41.667 0.0 0.0 39.00 1.40
2221 2229 3.289407 AGCCCCTTCTTGCTCTTATTC 57.711 47.619 0.0 0.0 30.33 1.75
2222 2230 2.849318 AGCCCCTTCTTGCTCTTATTCT 59.151 45.455 0.0 0.0 30.33 2.40
2223 2231 3.268072 AGCCCCTTCTTGCTCTTATTCTT 59.732 43.478 0.0 0.0 30.33 2.52
2224 2232 4.475016 AGCCCCTTCTTGCTCTTATTCTTA 59.525 41.667 0.0 0.0 30.33 2.10
2225 2233 5.133491 AGCCCCTTCTTGCTCTTATTCTTAT 59.867 40.000 0.0 0.0 30.33 1.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
740 741 3.605461 CGCATGGCACGAAAATCTATCTG 60.605 47.826 0.0 0.0 0.00 2.90
844 845 1.305887 CTAGGGGGTCCGTCAACCT 60.306 63.158 0.0 0.0 39.42 3.50
862 863 8.770010 AGGTAATCATCAGGTATAGGTATAGC 57.230 38.462 0.0 0.0 37.03 2.97
2225 2233 9.893634 TTGTATTCCACCGAATAAGAATAAGAA 57.106 29.630 0.0 0.0 41.53 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.