Multiple sequence alignment - TraesCS5A01G019900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G019900 chr5A 100.000 3530 0 0 1 3530 16542562 16546091 0.000000e+00 6519.0
1 TraesCS5A01G019900 chr5A 99.083 3488 31 1 43 3530 420183753 420187239 0.000000e+00 6263.0
2 TraesCS5A01G019900 chr7B 99.341 3488 23 0 43 3530 742950688 742947201 0.000000e+00 6314.0
3 TraesCS5A01G019900 chr7B 98.968 3489 34 2 43 3530 716782657 716786144 0.000000e+00 6242.0
4 TraesCS5A01G019900 chr7A 99.255 3488 26 0 43 3530 60170717 60167230 0.000000e+00 6298.0
5 TraesCS5A01G019900 chr7A 99.285 3355 22 2 176 3530 60083121 60086473 0.000000e+00 6061.0
6 TraesCS5A01G019900 chr2A 98.950 3428 35 1 43 3469 755478598 755482025 0.000000e+00 6130.0
7 TraesCS5A01G019900 chr6B 97.936 3488 70 2 43 3530 388288986 388285501 0.000000e+00 6041.0
8 TraesCS5A01G019900 chr4D 98.619 3258 43 2 43 3299 123348172 123351428 0.000000e+00 5766.0
9 TraesCS5A01G019900 chr2D 96.531 3488 107 7 43 3530 291771669 291775142 0.000000e+00 5758.0
10 TraesCS5A01G019900 chr5B 97.995 399 7 1 3132 3530 680040521 680040918 0.000000e+00 691.0
11 TraesCS5A01G019900 chrUn 100.000 45 0 0 1 45 182452867 182452911 2.260000e-12 84.2
12 TraesCS5A01G019900 chr6D 100.000 45 0 0 1 45 283144108 283144064 2.260000e-12 84.2
13 TraesCS5A01G019900 chr6D 100.000 45 0 0 1 45 369908007 369907963 2.260000e-12 84.2
14 TraesCS5A01G019900 chr6D 100.000 45 0 0 1 45 369990358 369990314 2.260000e-12 84.2
15 TraesCS5A01G019900 chr6D 100.000 45 0 0 1 45 370020500 370020544 2.260000e-12 84.2
16 TraesCS5A01G019900 chr1D 100.000 45 0 0 1 45 85099679 85099723 2.260000e-12 84.2
17 TraesCS5A01G019900 chr1D 100.000 45 0 0 1 45 185745781 185745737 2.260000e-12 84.2
18 TraesCS5A01G019900 chr2B 91.379 58 3 2 1 57 310039783 310039727 1.050000e-10 78.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G019900 chr5A 16542562 16546091 3529 False 6519 6519 100.000 1 3530 1 chr5A.!!$F1 3529
1 TraesCS5A01G019900 chr5A 420183753 420187239 3486 False 6263 6263 99.083 43 3530 1 chr5A.!!$F2 3487
2 TraesCS5A01G019900 chr7B 742947201 742950688 3487 True 6314 6314 99.341 43 3530 1 chr7B.!!$R1 3487
3 TraesCS5A01G019900 chr7B 716782657 716786144 3487 False 6242 6242 98.968 43 3530 1 chr7B.!!$F1 3487
4 TraesCS5A01G019900 chr7A 60167230 60170717 3487 True 6298 6298 99.255 43 3530 1 chr7A.!!$R1 3487
5 TraesCS5A01G019900 chr7A 60083121 60086473 3352 False 6061 6061 99.285 176 3530 1 chr7A.!!$F1 3354
6 TraesCS5A01G019900 chr2A 755478598 755482025 3427 False 6130 6130 98.950 43 3469 1 chr2A.!!$F1 3426
7 TraesCS5A01G019900 chr6B 388285501 388288986 3485 True 6041 6041 97.936 43 3530 1 chr6B.!!$R1 3487
8 TraesCS5A01G019900 chr4D 123348172 123351428 3256 False 5766 5766 98.619 43 3299 1 chr4D.!!$F1 3256
9 TraesCS5A01G019900 chr2D 291771669 291775142 3473 False 5758 5758 96.531 43 3530 1 chr2D.!!$F1 3487

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
41 42 0.108138 AGGCTCGTTGCTTCGCTTAT 60.108 50.000 3.58 0.0 42.39 1.73 F
939 942 7.572759 TCAAATCGAGATTGTGTGAAGTAAAC 58.427 34.615 12.00 0.0 0.00 2.01 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1434 1437 0.469705 AGCCTGTTTGCATGGGTTCA 60.470 50.000 0.0 0.0 0.00 3.18 R
2737 2740 1.305887 CTAGGGGGTCCGTCAACCT 60.306 63.158 0.0 0.0 39.42 3.50 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
25 26 4.620589 GAAGGTATTTCCCCTACTAGGC 57.379 50.000 0.00 0.0 36.75 3.93
26 27 4.232909 GAAGGTATTTCCCCTACTAGGCT 58.767 47.826 0.00 0.0 36.75 4.58
27 28 3.859370 AGGTATTTCCCCTACTAGGCTC 58.141 50.000 0.00 0.0 36.75 4.70
28 29 2.561858 GGTATTTCCCCTACTAGGCTCG 59.438 54.545 0.00 0.0 32.73 5.03
29 30 2.473576 ATTTCCCCTACTAGGCTCGT 57.526 50.000 0.00 0.0 32.73 4.18
30 31 2.242882 TTTCCCCTACTAGGCTCGTT 57.757 50.000 0.00 0.0 32.73 3.85
31 32 1.481871 TTCCCCTACTAGGCTCGTTG 58.518 55.000 0.00 0.0 32.73 4.10
32 33 1.041447 TCCCCTACTAGGCTCGTTGC 61.041 60.000 0.00 0.0 41.94 4.17
33 34 1.043673 CCCCTACTAGGCTCGTTGCT 61.044 60.000 0.00 0.0 42.39 3.91
34 35 0.824759 CCCTACTAGGCTCGTTGCTT 59.175 55.000 0.00 0.0 42.39 3.91
35 36 1.202428 CCCTACTAGGCTCGTTGCTTC 60.202 57.143 0.00 0.0 42.39 3.86
36 37 1.534175 CCTACTAGGCTCGTTGCTTCG 60.534 57.143 0.00 0.0 42.39 3.79
37 38 0.179145 TACTAGGCTCGTTGCTTCGC 60.179 55.000 0.00 0.0 42.39 4.70
38 39 1.153745 CTAGGCTCGTTGCTTCGCT 60.154 57.895 0.00 0.0 42.39 4.93
39 40 0.737715 CTAGGCTCGTTGCTTCGCTT 60.738 55.000 0.00 0.0 42.39 4.68
40 41 0.528924 TAGGCTCGTTGCTTCGCTTA 59.471 50.000 0.00 0.0 42.39 3.09
41 42 0.108138 AGGCTCGTTGCTTCGCTTAT 60.108 50.000 3.58 0.0 42.39 1.73
939 942 7.572759 TCAAATCGAGATTGTGTGAAGTAAAC 58.427 34.615 12.00 0.0 0.00 2.01
1434 1437 7.417612 GGATTATTGAACGTAAATCTGTGCAT 58.582 34.615 0.00 0.0 0.00 3.96
1749 1752 1.660560 CTCTGCAATTTCTGGCCCCG 61.661 60.000 0.00 0.0 0.00 5.73
2737 2740 4.232061 CCCACCCAGCCCCACAAA 62.232 66.667 0.00 0.0 0.00 2.83
2755 2758 0.908180 AAGGTTGACGGACCCCCTAG 60.908 60.000 1.80 0.0 40.73 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
4 5 4.232909 AGCCTAGTAGGGGAAATACCTTC 58.767 47.826 18.13 0.00 39.54 3.46
5 6 4.232909 GAGCCTAGTAGGGGAAATACCTT 58.767 47.826 18.13 0.00 39.54 3.50
6 7 3.754500 CGAGCCTAGTAGGGGAAATACCT 60.754 52.174 18.13 3.49 42.15 3.08
7 8 2.561858 CGAGCCTAGTAGGGGAAATACC 59.438 54.545 18.13 0.00 35.37 2.73
8 9 3.229293 ACGAGCCTAGTAGGGGAAATAC 58.771 50.000 18.13 0.00 35.37 1.89
9 10 3.607490 ACGAGCCTAGTAGGGGAAATA 57.393 47.619 18.13 0.00 35.37 1.40
10 11 2.434702 CAACGAGCCTAGTAGGGGAAAT 59.565 50.000 18.13 0.00 35.37 2.17
11 12 1.829222 CAACGAGCCTAGTAGGGGAAA 59.171 52.381 18.13 0.00 35.37 3.13
12 13 1.481871 CAACGAGCCTAGTAGGGGAA 58.518 55.000 18.13 0.00 35.37 3.97
13 14 1.041447 GCAACGAGCCTAGTAGGGGA 61.041 60.000 18.13 0.00 35.37 4.81
14 15 1.442148 GCAACGAGCCTAGTAGGGG 59.558 63.158 18.13 0.00 35.37 4.79
33 34 8.859156 GCACTTTTCAATCAATTAATAAGCGAA 58.141 29.630 0.00 0.00 0.00 4.70
34 35 8.243426 AGCACTTTTCAATCAATTAATAAGCGA 58.757 29.630 0.00 0.00 0.00 4.93
35 36 8.398491 AGCACTTTTCAATCAATTAATAAGCG 57.602 30.769 0.00 0.00 0.00 4.68
36 37 8.526681 CGAGCACTTTTCAATCAATTAATAAGC 58.473 33.333 0.00 0.00 0.00 3.09
37 38 8.526681 GCGAGCACTTTTCAATCAATTAATAAG 58.473 33.333 0.00 0.00 0.00 1.73
38 39 7.487829 GGCGAGCACTTTTCAATCAATTAATAA 59.512 33.333 0.00 0.00 0.00 1.40
39 40 6.972328 GGCGAGCACTTTTCAATCAATTAATA 59.028 34.615 0.00 0.00 0.00 0.98
40 41 5.807011 GGCGAGCACTTTTCAATCAATTAAT 59.193 36.000 0.00 0.00 0.00 1.40
41 42 5.048083 AGGCGAGCACTTTTCAATCAATTAA 60.048 36.000 0.00 0.00 0.00 1.40
939 942 6.865205 AGAAATCCGCTTTCAAGAAAAAGATG 59.135 34.615 10.22 0.00 44.82 2.90
1434 1437 0.469705 AGCCTGTTTGCATGGGTTCA 60.470 50.000 0.00 0.00 0.00 3.18
1622 1625 2.032377 GTCGAGCGTTTTTGTCCAATCA 60.032 45.455 0.00 0.00 0.00 2.57
2633 2636 3.605461 CGCATGGCACGAAAATCTATCTG 60.605 47.826 0.00 0.00 0.00 2.90
2737 2740 1.305887 CTAGGGGGTCCGTCAACCT 60.306 63.158 0.00 0.00 39.42 3.50
2755 2758 8.770010 AGGTAATCATCAGGTATAGGTATAGC 57.230 38.462 0.00 0.00 37.03 2.97


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.