Multiple sequence alignment - TraesCS5A01G006600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G006600 chr5A 100.000 3136 0 0 1 3136 3990976 3994111 0 5792
1 TraesCS5A01G006600 chr5A 98.754 2247 21 4 896 3136 601209320 601207075 0 3988
2 TraesCS5A01G006600 chr5A 99.777 896 2 0 1 896 3984223 3985118 0 1644
3 TraesCS5A01G006600 chr5A 99.554 897 4 0 4 900 644980822 644979926 0 1635
4 TraesCS5A01G006600 chr2A 99.109 2244 17 2 896 3136 710248899 710251142 0 4030
5 TraesCS5A01G006600 chr7A 99.064 2243 16 2 896 3136 664221451 664219212 0 4021
6 TraesCS5A01G006600 chr7A 99.665 895 3 0 1 895 728067548 728068442 0 1637
7 TraesCS5A01G006600 chr4B 98.751 2241 28 0 896 3136 531077681 531079921 0 3984
8 TraesCS5A01G006600 chr4B 99.776 894 2 0 4 897 86147027 86146134 0 1640
9 TraesCS5A01G006600 chr6B 96.433 2243 76 3 896 3136 612966104 612968344 0 3696
10 TraesCS5A01G006600 chr6B 95.268 2261 78 4 903 3136 92572160 92574418 0 3555
11 TraesCS5A01G006600 chr3B 94.245 2259 75 7 908 3136 823328190 823330423 0 3400
12 TraesCS5A01G006600 chr3B 97.367 1709 43 2 1429 3136 82367210 82365503 0 2905
13 TraesCS5A01G006600 chr3B 97.307 557 15 0 896 1452 82367773 82367217 0 946
14 TraesCS5A01G006600 chr4A 97.343 1957 31 2 1200 3136 507909080 507911035 0 3306
15 TraesCS5A01G006600 chr4A 99.888 893 1 0 4 896 418039624 418038732 0 1644
16 TraesCS5A01G006600 chr4A 99.776 893 2 0 4 896 459835732 459834840 0 1639
17 TraesCS5A01G006600 chr4A 99.122 911 6 2 1 909 175515359 175514449 0 1637
18 TraesCS5A01G006600 chr6A 97.089 1958 36 2 1200 3136 338113284 338115241 0 3280
19 TraesCS5A01G006600 chr7B 94.762 1470 60 4 906 2360 665248630 665247163 0 2272
20 TraesCS5A01G006600 chr3A 99.776 893 2 0 4 896 32441985 32441093 0 1639
21 TraesCS5A01G006600 chr3A 99.334 901 4 2 4 904 32435217 32434319 0 1629


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G006600 chr5A 3990976 3994111 3135 False 5792.0 5792 100.000 1 3136 1 chr5A.!!$F2 3135
1 TraesCS5A01G006600 chr5A 601207075 601209320 2245 True 3988.0 3988 98.754 896 3136 1 chr5A.!!$R1 2240
2 TraesCS5A01G006600 chr5A 3984223 3985118 895 False 1644.0 1644 99.777 1 896 1 chr5A.!!$F1 895
3 TraesCS5A01G006600 chr5A 644979926 644980822 896 True 1635.0 1635 99.554 4 900 1 chr5A.!!$R2 896
4 TraesCS5A01G006600 chr2A 710248899 710251142 2243 False 4030.0 4030 99.109 896 3136 1 chr2A.!!$F1 2240
5 TraesCS5A01G006600 chr7A 664219212 664221451 2239 True 4021.0 4021 99.064 896 3136 1 chr7A.!!$R1 2240
6 TraesCS5A01G006600 chr7A 728067548 728068442 894 False 1637.0 1637 99.665 1 895 1 chr7A.!!$F1 894
7 TraesCS5A01G006600 chr4B 531077681 531079921 2240 False 3984.0 3984 98.751 896 3136 1 chr4B.!!$F1 2240
8 TraesCS5A01G006600 chr4B 86146134 86147027 893 True 1640.0 1640 99.776 4 897 1 chr4B.!!$R1 893
9 TraesCS5A01G006600 chr6B 612966104 612968344 2240 False 3696.0 3696 96.433 896 3136 1 chr6B.!!$F2 2240
10 TraesCS5A01G006600 chr6B 92572160 92574418 2258 False 3555.0 3555 95.268 903 3136 1 chr6B.!!$F1 2233
11 TraesCS5A01G006600 chr3B 823328190 823330423 2233 False 3400.0 3400 94.245 908 3136 1 chr3B.!!$F1 2228
12 TraesCS5A01G006600 chr3B 82365503 82367773 2270 True 1925.5 2905 97.337 896 3136 2 chr3B.!!$R1 2240
13 TraesCS5A01G006600 chr4A 507909080 507911035 1955 False 3306.0 3306 97.343 1200 3136 1 chr4A.!!$F1 1936
14 TraesCS5A01G006600 chr4A 418038732 418039624 892 True 1644.0 1644 99.888 4 896 1 chr4A.!!$R2 892
15 TraesCS5A01G006600 chr4A 459834840 459835732 892 True 1639.0 1639 99.776 4 896 1 chr4A.!!$R3 892
16 TraesCS5A01G006600 chr4A 175514449 175515359 910 True 1637.0 1637 99.122 1 909 1 chr4A.!!$R1 908
17 TraesCS5A01G006600 chr6A 338113284 338115241 1957 False 3280.0 3280 97.089 1200 3136 1 chr6A.!!$F1 1936
18 TraesCS5A01G006600 chr7B 665247163 665248630 1467 True 2272.0 2272 94.762 906 2360 1 chr7B.!!$R1 1454
19 TraesCS5A01G006600 chr3A 32441093 32441985 892 True 1639.0 1639 99.776 4 896 1 chr3A.!!$R2 892
20 TraesCS5A01G006600 chr3A 32434319 32435217 898 True 1629.0 1629 99.334 4 904 1 chr3A.!!$R1 900

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1464 1509 1.768684 TATCTCTTCATGCGGCCCCC 61.769 60.0 0.0 0.0 0.0 5.4 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2443 2491 4.023193 GTGACTTGTCAAATTCCCGTGAAT 60.023 41.667 4.93 0.0 43.08 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1464 1509 1.768684 TATCTCTTCATGCGGCCCCC 61.769 60.000 0.0 0.0 0.00 5.40
1655 1700 4.591498 TGGTTCTTGCTCTTGGAGTTACTA 59.409 41.667 0.0 0.0 31.39 1.82
1838 1886 6.404708 TGGTATTTGTACCGTGCAGTATTAA 58.595 36.000 0.0 0.0 42.95 1.40
1866 1914 1.812235 TGTGCTTACAGCCTCACATG 58.188 50.000 0.0 0.0 41.51 3.21
2891 2950 5.949952 TGTATGCAAGAGTGACCTTCTACTA 59.050 40.000 0.0 0.0 0.00 1.82
2892 2951 4.785511 TGCAAGAGTGACCTTCTACTAC 57.214 45.455 0.0 0.0 0.00 2.73
2931 2990 8.713271 GTTCCGTTTAAAAATAAATTCCATGCA 58.287 29.630 0.0 0.0 0.00 3.96
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1464 1509 4.884744 TCTCGAAAGATTACAGAGAGGGAG 59.115 45.833 0.00 0.00 40.84 4.30
1655 1700 5.649395 CACCTGGAGTGTTGAATGTATTCAT 59.351 40.000 8.02 0.00 40.87 2.57
1675 1720 0.682209 GGCAATGCTCCATCACACCT 60.682 55.000 4.82 0.00 0.00 4.00
1866 1914 3.773119 TCCTCCACTACCTGACATTTACC 59.227 47.826 0.00 0.00 0.00 2.85
2443 2491 4.023193 GTGACTTGTCAAATTCCCGTGAAT 60.023 41.667 4.93 0.00 43.08 2.57
2891 2950 8.891671 TTTAAACGGAACACTACATTTAGAGT 57.108 30.769 0.00 0.00 31.07 3.24
2919 2978 9.941325 ACACATTAAATCTTTGCATGGAATTTA 57.059 25.926 0.00 0.37 0.00 1.40
2931 2990 8.475331 AGTTCGATCGTACACATTAAATCTTT 57.525 30.769 24.05 0.00 0.00 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.