Multiple sequence alignment - TraesCS5A01G000500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS5A01G000500 chr5A 100.000 2324 0 0 1 2324 307895 305572 0.000000e+00 4292.0
1 TraesCS5A01G000500 chr5B 99.013 2330 17 3 1 2324 2017552 2015223 0.000000e+00 4170.0
2 TraesCS5A01G000500 chr5B 89.434 1448 85 23 907 2324 1579307 1580716 0.000000e+00 1764.0
3 TraesCS5A01G000500 chr5B 92.395 618 17 12 907 1519 5920111 5919519 0.000000e+00 854.0
4 TraesCS5A01G000500 chr5B 90.196 51 5 0 845 895 1579111 1579161 1.490000e-07 67.6
5 TraesCS5A01G000500 chr5B 88.889 54 6 0 845 898 5920307 5920254 1.490000e-07 67.6
6 TraesCS5A01G000500 chrUn 89.434 1448 85 23 907 2324 144675766 144674357 0.000000e+00 1764.0
7 TraesCS5A01G000500 chrUn 89.459 1442 84 24 913 2324 162185398 162183995 0.000000e+00 1759.0
8 TraesCS5A01G000500 chrUn 89.365 1448 86 24 907 2324 222147657 222149066 0.000000e+00 1759.0
9 TraesCS5A01G000500 chrUn 85.666 1186 86 34 1185 2324 162181826 162180679 0.000000e+00 1171.0
10 TraesCS5A01G000500 chrUn 88.889 54 6 0 845 898 144675962 144675909 1.490000e-07 67.6
11 TraesCS5A01G000500 chrUn 88.889 54 6 0 845 898 162185597 162185544 1.490000e-07 67.6
12 TraesCS5A01G000500 chrUn 100.000 34 0 0 862 895 222147478 222147511 1.930000e-06 63.9
13 TraesCS5A01G000500 chr5D 92.004 1113 52 6 907 2004 360283 361373 0.000000e+00 1528.0
14 TraesCS5A01G000500 chr5D 91.853 1117 54 6 907 2008 145267 146361 0.000000e+00 1524.0
15 TraesCS5A01G000500 chr5D 91.465 1113 57 7 907 2004 105318 106407 0.000000e+00 1495.0
16 TraesCS5A01G000500 chr5D 91.648 910 55 10 1 910 144236 145124 0.000000e+00 1240.0
17 TraesCS5A01G000500 chr5D 91.247 914 57 10 1 910 359246 360140 0.000000e+00 1223.0
18 TraesCS5A01G000500 chr5D 90.449 890 64 10 21 910 104308 105176 0.000000e+00 1153.0
19 TraesCS5A01G000500 chr5D 90.970 742 48 8 21 762 98560 99282 0.000000e+00 981.0
20 TraesCS5A01G000500 chr5D 90.701 742 50 6 21 762 101438 102160 0.000000e+00 970.0
21 TraesCS5A01G000500 chr5D 90.566 742 51 5 21 762 102872 103594 0.000000e+00 965.0
22 TraesCS5A01G000500 chr5D 90.457 744 50 7 21 762 99279 100003 0.000000e+00 961.0
23 TraesCS5A01G000500 chr5D 90.162 742 54 7 21 762 100719 101441 0.000000e+00 948.0
24 TraesCS5A01G000500 chr5D 90.040 743 53 9 21 762 100000 100722 0.000000e+00 942.0
25 TraesCS5A01G000500 chr5D 90.040 743 49 10 21 762 102157 102875 0.000000e+00 939.0
26 TraesCS5A01G000500 chr5D 97.799 318 6 1 2008 2324 106443 106760 4.370000e-152 547.0
27 TraesCS5A01G000500 chr5D 97.799 318 6 1 2008 2324 361409 361726 4.370000e-152 547.0
28 TraesCS5A01G000500 chr5D 96.855 318 8 2 2008 2324 146393 146709 4.400000e-147 531.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS5A01G000500 chr5A 305572 307895 2323 True 4292.000000 4292 100.000000 1 2324 1 chr5A.!!$R1 2323
1 TraesCS5A01G000500 chr5B 2015223 2017552 2329 True 4170.000000 4170 99.013000 1 2324 1 chr5B.!!$R1 2323
2 TraesCS5A01G000500 chr5B 1579111 1580716 1605 False 915.800000 1764 89.815000 845 2324 2 chr5B.!!$F1 1479
3 TraesCS5A01G000500 chr5B 5919519 5920307 788 True 460.800000 854 90.642000 845 1519 2 chr5B.!!$R2 674
4 TraesCS5A01G000500 chrUn 162180679 162185597 4918 True 999.200000 1759 88.004667 845 2324 3 chrUn.!!$R2 1479
5 TraesCS5A01G000500 chrUn 144674357 144675962 1605 True 915.800000 1764 89.161500 845 2324 2 chrUn.!!$R1 1479
6 TraesCS5A01G000500 chrUn 222147478 222149066 1588 False 911.450000 1759 94.682500 862 2324 2 chrUn.!!$F1 1462
7 TraesCS5A01G000500 chr5D 359246 361726 2480 False 1099.333333 1528 93.683333 1 2324 3 chr5D.!!$F3 2323
8 TraesCS5A01G000500 chr5D 144236 146709 2473 False 1098.333333 1524 93.452000 1 2324 3 chr5D.!!$F2 2323
9 TraesCS5A01G000500 chr5D 98560 106760 8200 False 990.100000 1495 91.264900 21 2324 10 chr5D.!!$F1 2303

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
722 6476 0.322636 ACCCAACAACACGAACCACA 60.323 50.0 0.0 0.0 0.0 4.17 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1884 7841 8.287439 TGCGATTATTTCCTAGGAAAAATTGA 57.713 30.769 32.67 22.2 45.6 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
363 5396 2.983030 GCCCACCACATCAACGCA 60.983 61.111 0.00 0.00 0.0 5.24
722 6476 0.322636 ACCCAACAACACGAACCACA 60.323 50.000 0.00 0.00 0.0 4.17
1478 7412 9.661563 TTAACAGACCGTCTTTTGTATTATGAT 57.338 29.630 9.73 0.00 0.0 2.45
1884 7841 7.790782 ACACCAGGAAACCACATTAATTAAT 57.209 32.000 4.81 4.81 0.0 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
185 5217 3.223157 GTGCGCCGTATTATTATGTTGC 58.777 45.455 4.18 0.0 0.0 4.17
722 6476 1.063488 GTTGGACGCGCTTTGTTGT 59.937 52.632 5.73 0.0 0.0 3.32
1478 7412 2.158769 AGTCACTGGAACAAGCATGTCA 60.159 45.455 0.00 0.0 39.4 3.58
1884 7841 8.287439 TGCGATTATTTCCTAGGAAAAATTGA 57.713 30.769 32.67 22.2 45.6 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.