Multiple sequence alignment - TraesCS4D01G350400

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G350400 chr4D 100.000 3835 0 0 1 3835 502618754 502622588 0 7083
1 TraesCS4D01G350400 chrUn 99.322 3835 25 1 1 3835 134333755 134329922 0 6937
2 TraesCS4D01G350400 chr3D 99.296 3835 26 1 1 3835 579344619 579348452 0 6931
3 TraesCS4D01G350400 chr2D 99.244 3837 26 2 1 3835 82250616 82246781 0 6922
4 TraesCS4D01G350400 chr3B 96.557 3137 107 1 1 3137 728851298 728854433 0 5193
5 TraesCS4D01G350400 chr6B 95.644 3145 127 7 1 3137 646100959 646104101 0 5040
6 TraesCS4D01G350400 chr1A 96.316 2579 91 4 476 3051 394485024 394487601 0 4233
7 TraesCS4D01G350400 chr1A 96.073 2343 89 3 711 3051 394415106 394417447 0 3814
8 TraesCS4D01G350400 chr5A 95.206 2545 117 5 476 3016 542029676 542027133 0 4019
9 TraesCS4D01G350400 chr4B 94.595 2109 105 6 909 3015 524149752 524147651 0 3254
10 TraesCS4D01G350400 chr4B 96.512 688 23 1 3148 3835 669430221 669430907 0 1136
11 TraesCS4D01G350400 chr4B 96.221 688 25 1 3148 3835 669203781 669203095 0 1125
12 TraesCS4D01G350400 chr4B 95.797 690 28 1 3146 3835 668306521 668307209 0 1112
13 TraesCS4D01G350400 chr7D 98.949 1712 17 1 1 1711 109456096 109457807 0 3061
14 TraesCS4D01G350400 chr7D 99.113 1128 9 1 2708 3835 109457801 109458927 0 2026
15 TraesCS4D01G350400 chr5D 99.212 888 6 1 2948 3835 531438778 531437892 0 1600
16 TraesCS4D01G350400 chr4A 95.356 689 31 1 3148 3835 687957964 687957276 0 1094


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G350400 chr4D 502618754 502622588 3834 False 7083.0 7083 100.000 1 3835 1 chr4D.!!$F1 3834
1 TraesCS4D01G350400 chrUn 134329922 134333755 3833 True 6937.0 6937 99.322 1 3835 1 chrUn.!!$R1 3834
2 TraesCS4D01G350400 chr3D 579344619 579348452 3833 False 6931.0 6931 99.296 1 3835 1 chr3D.!!$F1 3834
3 TraesCS4D01G350400 chr2D 82246781 82250616 3835 True 6922.0 6922 99.244 1 3835 1 chr2D.!!$R1 3834
4 TraesCS4D01G350400 chr3B 728851298 728854433 3135 False 5193.0 5193 96.557 1 3137 1 chr3B.!!$F1 3136
5 TraesCS4D01G350400 chr6B 646100959 646104101 3142 False 5040.0 5040 95.644 1 3137 1 chr6B.!!$F1 3136
6 TraesCS4D01G350400 chr1A 394485024 394487601 2577 False 4233.0 4233 96.316 476 3051 1 chr1A.!!$F2 2575
7 TraesCS4D01G350400 chr1A 394415106 394417447 2341 False 3814.0 3814 96.073 711 3051 1 chr1A.!!$F1 2340
8 TraesCS4D01G350400 chr5A 542027133 542029676 2543 True 4019.0 4019 95.206 476 3016 1 chr5A.!!$R1 2540
9 TraesCS4D01G350400 chr4B 524147651 524149752 2101 True 3254.0 3254 94.595 909 3015 1 chr4B.!!$R1 2106
10 TraesCS4D01G350400 chr4B 669430221 669430907 686 False 1136.0 1136 96.512 3148 3835 1 chr4B.!!$F2 687
11 TraesCS4D01G350400 chr4B 669203095 669203781 686 True 1125.0 1125 96.221 3148 3835 1 chr4B.!!$R2 687
12 TraesCS4D01G350400 chr4B 668306521 668307209 688 False 1112.0 1112 95.797 3146 3835 1 chr4B.!!$F1 689
13 TraesCS4D01G350400 chr7D 109456096 109458927 2831 False 2543.5 3061 99.031 1 3835 2 chr7D.!!$F1 3834
14 TraesCS4D01G350400 chr5D 531437892 531438778 886 True 1600.0 1600 99.212 2948 3835 1 chr5D.!!$R1 887
15 TraesCS4D01G350400 chr4A 687957276 687957964 688 True 1094.0 1094 95.356 3148 3835 1 chr4A.!!$R1 687

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1031 1037 2.596046 TGGAAACAATGCGCCGGT 60.596 55.556 4.18 0.0 37.44 5.28 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2995 3008 6.413818 CGTCAGACAAACAGAAATTACCAAAC 59.586 38.462 0.41 0.0 0.0 2.93 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
1031 1037 2.596046 TGGAAACAATGCGCCGGT 60.596 55.556 4.18 0.00 37.44 5.28
1228 1234 8.531146 TGGAAGATGCACTCGAATATATATTCA 58.469 33.333 27.19 16.77 41.59 2.57
1408 1414 1.209127 CTTACGTTTTGCGGCCAGG 59.791 57.895 2.24 0.00 46.52 4.45
2995 3008 5.704888 TGGTTTCGCTGTTATATTTGTTGG 58.295 37.500 0.00 0.00 0.00 3.77
3102 3116 7.254117 CGTTTCTGATATGTTTAGCGACTCAAT 60.254 37.037 0.00 0.00 0.00 2.57
3399 3413 2.625314 TGCATCAAGGATAGAGGACGAG 59.375 50.000 0.00 0.00 0.00 4.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
14 15 2.519771 TGGACCCGCCGTCTATATAT 57.480 50.000 0.00 0.0 41.64 0.86
150 151 6.776603 ACTTAGGCGTATAAACAGTATCTCCT 59.223 38.462 0.00 0.0 0.00 3.69
1031 1037 1.303561 GCTGCCACAACCTGGATCA 60.304 57.895 0.00 0.0 43.95 2.92
1228 1234 1.803334 TGAACGCCGTTCATAAAGCT 58.197 45.000 27.27 0.0 45.88 3.74
1395 1401 0.887387 TGTACTCCTGGCCGCAAAAC 60.887 55.000 0.00 0.0 0.00 2.43
2995 3008 6.413818 CGTCAGACAAACAGAAATTACCAAAC 59.586 38.462 0.41 0.0 0.00 2.93


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.