Multiple sequence alignment - TraesCS4D01G338200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G338200 chr4D 100.000 2298 0 0 1 2298 496006297 496008594 0.000000e+00 4244.0
1 TraesCS4D01G338200 chr4D 98.182 55 1 0 1 55 30903977 30904031 1.880000e-16 97.1
2 TraesCS4D01G338200 chr7D 97.985 2233 43 2 55 2286 463977703 463979934 0.000000e+00 3873.0
3 TraesCS4D01G338200 chr7D 100.000 55 0 0 1 55 49877377 49877431 4.040000e-18 102.0
4 TraesCS4D01G338200 chr7D 98.182 55 1 0 1 55 501826040 501825986 1.880000e-16 97.1
5 TraesCS4D01G338200 chr2D 97.671 2233 50 2 55 2286 63681815 63684046 0.000000e+00 3834.0
6 TraesCS4D01G338200 chr2D 98.182 55 1 0 1 55 640885758 640885704 1.880000e-16 97.1
7 TraesCS4D01G338200 chr5D 97.494 2235 51 4 55 2286 60521521 60519289 0.000000e+00 3812.0
8 TraesCS4D01G338200 chr5D 100.000 55 0 0 1 55 60521617 60521563 4.040000e-18 102.0
9 TraesCS4D01G338200 chr6D 97.325 2206 58 1 55 2260 80672911 80670707 0.000000e+00 3746.0
10 TraesCS4D01G338200 chr6D 98.182 55 1 0 1 55 80673007 80672953 1.880000e-16 97.1
11 TraesCS4D01G338200 chr7A 96.822 2234 68 3 55 2286 89990507 89988275 0.000000e+00 3729.0
12 TraesCS4D01G338200 chr3A 96.637 2230 73 2 58 2286 328922776 328925004 0.000000e+00 3701.0
13 TraesCS4D01G338200 chr3D 96.590 2229 73 3 58 2286 582796970 582799195 0.000000e+00 3692.0
14 TraesCS4D01G338200 chr1B 96.078 2244 74 7 55 2285 615477043 615479285 0.000000e+00 3644.0
15 TraesCS4D01G338200 chr2B 96.077 2243 74 7 55 2285 90758947 90761187 0.000000e+00 3642.0
16 TraesCS4D01G338200 chr7B 98.214 56 0 1 1 55 144749192 144749247 1.880000e-16 97.1
17 TraesCS4D01G338200 chr6A 98.182 55 1 0 1 55 36427299 36427245 1.880000e-16 97.1
18 TraesCS4D01G338200 chr5A 98.182 55 1 0 1 55 27595332 27595386 1.880000e-16 97.1


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G338200 chr4D 496006297 496008594 2297 False 4244.00 4244 100.0000 1 2298 1 chr4D.!!$F2 2297
1 TraesCS4D01G338200 chr7D 463977703 463979934 2231 False 3873.00 3873 97.9850 55 2286 1 chr7D.!!$F2 2231
2 TraesCS4D01G338200 chr2D 63681815 63684046 2231 False 3834.00 3834 97.6710 55 2286 1 chr2D.!!$F1 2231
3 TraesCS4D01G338200 chr5D 60519289 60521617 2328 True 1957.00 3812 98.7470 1 2286 2 chr5D.!!$R1 2285
4 TraesCS4D01G338200 chr6D 80670707 80673007 2300 True 1921.55 3746 97.7535 1 2260 2 chr6D.!!$R1 2259
5 TraesCS4D01G338200 chr7A 89988275 89990507 2232 True 3729.00 3729 96.8220 55 2286 1 chr7A.!!$R1 2231
6 TraesCS4D01G338200 chr3A 328922776 328925004 2228 False 3701.00 3701 96.6370 58 2286 1 chr3A.!!$F1 2228
7 TraesCS4D01G338200 chr3D 582796970 582799195 2225 False 3692.00 3692 96.5900 58 2286 1 chr3D.!!$F1 2228
8 TraesCS4D01G338200 chr1B 615477043 615479285 2242 False 3644.00 3644 96.0780 55 2285 1 chr1B.!!$F1 2230
9 TraesCS4D01G338200 chr2B 90758947 90761187 2240 False 3642.00 3642 96.0770 55 2285 1 chr2B.!!$F1 2230

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
374 422 0.965439 TTAAAGGCACACCACCATGC 59.035 50.0 0.0 0.0 41.29 4.06 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1638 1694 1.212616 GATCATCTTCAACTCGGGCG 58.787 55.0 0.0 0.0 0.0 6.13 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
374 422 0.965439 TTAAAGGCACACCACCATGC 59.035 50.000 0.00 0.00 41.29 4.06
393 441 1.361668 CCTGAACTCGACGGCCATTG 61.362 60.000 2.24 0.00 0.00 2.82
589 637 2.522367 TTGAACCTCCCCCGTGGAC 61.522 63.158 0.00 0.00 38.61 4.02
821 869 1.422402 GTTAAGTGGAGTTGGGGGTCA 59.578 52.381 0.00 0.00 0.00 4.02
932 982 2.360483 TGTGTACAAATGTGCAGTTGGG 59.640 45.455 15.25 0.00 41.15 4.12
1011 1061 0.749454 AGATTTGGATGTGGGAGCGC 60.749 55.000 0.00 0.00 0.00 5.92
1219 1269 3.713858 TTATCAAATGCCTTGCCATCG 57.286 42.857 0.00 0.00 34.76 3.84
1277 1330 7.663493 TGACATGTTGTGATGTAGGTTAATTGA 59.337 33.333 0.00 0.00 36.67 2.57
1638 1694 2.479566 TGTGGAATGCTCAGAGGAAC 57.520 50.000 0.00 0.00 0.00 3.62
1781 1837 2.375174 TGGAAGTAATGCCAAGTGAGGT 59.625 45.455 0.00 0.00 0.00 3.85
2286 2349 1.519246 CATCTTCCAGCCGAGCAGA 59.481 57.895 0.00 0.00 0.00 4.26
2287 2350 0.107993 CATCTTCCAGCCGAGCAGAA 60.108 55.000 0.00 1.24 0.00 3.02
2288 2351 0.615331 ATCTTCCAGCCGAGCAGAAA 59.385 50.000 0.00 0.00 0.00 2.52
2289 2352 0.615331 TCTTCCAGCCGAGCAGAAAT 59.385 50.000 0.00 0.00 0.00 2.17
2290 2353 1.012841 CTTCCAGCCGAGCAGAAATC 58.987 55.000 0.00 0.00 0.00 2.17
2292 2355 0.615331 TCCAGCCGAGCAGAAATCTT 59.385 50.000 0.00 0.00 0.00 2.40
2294 2357 1.399791 CCAGCCGAGCAGAAATCTTTC 59.600 52.381 0.00 0.00 37.45 2.62
2296 2359 0.735471 GCCGAGCAGAAATCTTTCCC 59.265 55.000 0.00 0.00 37.92 3.97
2297 2360 1.950484 GCCGAGCAGAAATCTTTCCCA 60.950 52.381 0.00 0.00 37.92 4.37
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
374 422 1.079127 AATGGCCGTCGAGTTCAGG 60.079 57.895 0.00 0.00 0.00 3.86
589 637 6.541641 CCTAGGATCCTTCTTTGTTTCATGAG 59.458 42.308 22.03 5.49 0.00 2.90
932 982 0.390860 ACTCCTCATACATGCTCCGC 59.609 55.000 0.00 0.00 0.00 5.54
1277 1330 2.433239 CCTAAGTACCATGTACGGCCTT 59.567 50.000 0.00 0.00 0.00 4.35
1638 1694 1.212616 GATCATCTTCAACTCGGGCG 58.787 55.000 0.00 0.00 0.00 6.13
1781 1837 1.962100 TGTTGAATGCACCATCAGCAA 59.038 42.857 11.41 0.00 46.27 3.91
1998 2054 1.747355 TCCTAATGAGACCGTCCGTTC 59.253 52.381 0.00 0.00 0.00 3.95


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.