Multiple sequence alignment - TraesCS4D01G333600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G333600 chr4D 100.000 2266 0 0 1 2266 490985958 490988223 0 4185
1 TraesCS4D01G333600 chr1D 99.031 2270 18 4 1 2266 256251900 256249631 0 4067
2 TraesCS4D01G333600 chr6D 98.973 1266 12 1 1002 2266 59097608 59098873 0 2265
3 TraesCS4D01G333600 chr3A 94.799 1365 62 7 906 2266 148053146 148051787 0 2119
4 TraesCS4D01G333600 chr3A 93.580 1106 69 2 1163 2266 17714382 17715487 0 1648
5 TraesCS4D01G333600 chr6B 89.279 1110 65 25 1163 2266 131648920 131647859 0 1341
6 TraesCS4D01G333600 chr6B 97.099 655 17 2 1413 2067 546999806 547000458 0 1103
7 TraesCS4D01G333600 chr3B 96.799 656 18 3 1413 2067 219463156 219462503 0 1092
8 TraesCS4D01G333600 chr2B 96.499 657 20 3 1413 2068 520186508 520185854 0 1083
9 TraesCS4D01G333600 chr7D 86.254 873 111 9 524 1391 87445035 87445903 0 939
10 TraesCS4D01G333600 chr7D 83.296 898 101 24 433 1320 87446776 87445918 0 782
11 TraesCS4D01G333600 chr4A 91.172 691 57 4 1577 2266 279473425 279472738 0 935
12 TraesCS4D01G333600 chr5A 94.108 611 35 1 1656 2266 169286200 169286809 0 928


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G333600 chr4D 490985958 490988223 2265 False 4185 4185 100.000 1 2266 1 chr4D.!!$F1 2265
1 TraesCS4D01G333600 chr1D 256249631 256251900 2269 True 4067 4067 99.031 1 2266 1 chr1D.!!$R1 2265
2 TraesCS4D01G333600 chr6D 59097608 59098873 1265 False 2265 2265 98.973 1002 2266 1 chr6D.!!$F1 1264
3 TraesCS4D01G333600 chr3A 148051787 148053146 1359 True 2119 2119 94.799 906 2266 1 chr3A.!!$R1 1360
4 TraesCS4D01G333600 chr3A 17714382 17715487 1105 False 1648 1648 93.580 1163 2266 1 chr3A.!!$F1 1103
5 TraesCS4D01G333600 chr6B 131647859 131648920 1061 True 1341 1341 89.279 1163 2266 1 chr6B.!!$R1 1103
6 TraesCS4D01G333600 chr6B 546999806 547000458 652 False 1103 1103 97.099 1413 2067 1 chr6B.!!$F1 654
7 TraesCS4D01G333600 chr3B 219462503 219463156 653 True 1092 1092 96.799 1413 2067 1 chr3B.!!$R1 654
8 TraesCS4D01G333600 chr2B 520185854 520186508 654 True 1083 1083 96.499 1413 2068 1 chr2B.!!$R1 655
9 TraesCS4D01G333600 chr7D 87445035 87445903 868 False 939 939 86.254 524 1391 1 chr7D.!!$F1 867
10 TraesCS4D01G333600 chr7D 87445918 87446776 858 True 782 782 83.296 433 1320 1 chr7D.!!$R1 887
11 TraesCS4D01G333600 chr4A 279472738 279473425 687 True 935 935 91.172 1577 2266 1 chr4A.!!$R1 689
12 TraesCS4D01G333600 chr5A 169286200 169286809 609 False 928 928 94.108 1656 2266 1 chr5A.!!$F1 610

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
270 271 1.933021 TAGAAGGAAGTTGGAGGCGA 58.067 50.0 0.0 0.0 0.0 5.54 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1973 2001 2.060326 TCCTTTGTAGACAACTCGCG 57.94 50.0 0.0 0.0 35.28 5.87 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
254 255 9.204570 GTTCAAGCTCTACTGTTGTTTTATAGA 57.795 33.333 0.00 0.0 0.00 1.98
270 271 1.933021 TAGAAGGAAGTTGGAGGCGA 58.067 50.000 0.00 0.0 0.00 5.54
288 289 2.789092 GCGACATTCGAAAATCCAGCAG 60.789 50.000 0.00 0.0 43.74 4.24
849 861 9.113838 GATAAGCTTCACTTCATTCTTATGGAA 57.886 33.333 0.00 0.0 39.97 3.53
1763 1782 0.528466 CGGATCATACTGCAGCACGT 60.528 55.000 15.27 0.0 0.00 4.49
2000 2029 2.108168 TGTCTACAAAGGATCCCCGAG 58.892 52.381 8.55 0.0 37.58 4.63
2092 2122 6.130723 GCATGATTGTGTGTTTCAATTTGTG 58.869 36.000 0.00 0.0 35.94 3.33
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
254 255 0.693049 ATGTCGCCTCCAACTTCCTT 59.307 50.000 0.00 0.00 0.00 3.36
270 271 2.795329 ACCTGCTGGATTTTCGAATGT 58.205 42.857 17.64 0.00 37.04 2.71
288 289 6.894339 TTTTTCATACCCAGAAGAAGAACC 57.106 37.500 0.00 0.00 0.00 3.62
849 861 7.573968 AACATGCTTGAGACTTAGAGTTTTT 57.426 32.000 6.60 0.00 0.00 1.94
856 868 6.713520 GCAATCTAACATGCTTGAGACTTAG 58.286 40.000 6.60 4.32 39.46 2.18
1763 1782 3.769739 AACTACTCACCATCAAGTGCA 57.230 42.857 0.00 0.00 37.68 4.57
1973 2001 2.060326 TCCTTTGTAGACAACTCGCG 57.940 50.000 0.00 0.00 35.28 5.87
2000 2029 6.019479 CGAGCTTTCTTTGTATACATCCTGTC 60.019 42.308 6.36 0.00 0.00 3.51
2092 2122 5.947443 ACCAAGTACGTGATAACTACACTC 58.053 41.667 10.61 0.00 36.29 3.51


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.