Multiple sequence alignment - TraesCS4D01G331000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G331000 chr4D 100.000 2471 0 0 1 2471 489010148 489007678 0 4564
1 TraesCS4D01G331000 chr4D 96.845 2472 74 3 1 2471 466950267 466952735 0 4130
2 TraesCS4D01G331000 chr4D 97.354 2419 60 4 53 2471 482596718 482594304 0 4109
3 TraesCS4D01G331000 chr3D 97.612 2471 57 1 1 2471 516290700 516288232 0 4235
4 TraesCS4D01G331000 chr3D 97.573 2472 55 4 1 2471 16702270 16699803 0 4228
5 TraesCS4D01G331000 chr3D 96.350 2493 69 1 1 2471 582435139 582437631 0 4080
6 TraesCS4D01G331000 chr2D 97.253 2475 61 4 1 2471 101758844 101756373 0 4187
7 TraesCS4D01G331000 chr2D 96.966 2472 68 6 1 2471 522818272 522820737 0 4143
8 TraesCS4D01G331000 chr2D 96.350 2493 67 5 1 2471 33425338 33422848 0 4078
9 TraesCS4D01G331000 chr1D 97.128 2472 69 2 1 2471 100579743 100582213 0 4170


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G331000 chr4D 489007678 489010148 2470 True 4564 4564 100.000 1 2471 1 chr4D.!!$R2 2470
1 TraesCS4D01G331000 chr4D 466950267 466952735 2468 False 4130 4130 96.845 1 2471 1 chr4D.!!$F1 2470
2 TraesCS4D01G331000 chr4D 482594304 482596718 2414 True 4109 4109 97.354 53 2471 1 chr4D.!!$R1 2418
3 TraesCS4D01G331000 chr3D 516288232 516290700 2468 True 4235 4235 97.612 1 2471 1 chr3D.!!$R2 2470
4 TraesCS4D01G331000 chr3D 16699803 16702270 2467 True 4228 4228 97.573 1 2471 1 chr3D.!!$R1 2470
5 TraesCS4D01G331000 chr3D 582435139 582437631 2492 False 4080 4080 96.350 1 2471 1 chr3D.!!$F1 2470
6 TraesCS4D01G331000 chr2D 101756373 101758844 2471 True 4187 4187 97.253 1 2471 1 chr2D.!!$R2 2470
7 TraesCS4D01G331000 chr2D 522818272 522820737 2465 False 4143 4143 96.966 1 2471 1 chr2D.!!$F1 2470
8 TraesCS4D01G331000 chr2D 33422848 33425338 2490 True 4078 4078 96.350 1 2471 1 chr2D.!!$R1 2470
9 TraesCS4D01G331000 chr1D 100579743 100582213 2470 False 4170 4170 97.128 1 2471 1 chr1D.!!$F1 2470

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
244 268 3.423154 CGGAGCGTTGAACTGGGC 61.423 66.667 0.0 0.0 0.0 5.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1721 1751 0.394216 ATGCCTGCCAAAGCGACATA 60.394 50.0 0.0 0.0 44.31 2.29 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
63 86 4.394920 CGCTCTCTCACTATATCTCTTCCC 59.605 50.000 0.00 0.00 0.00 3.97
244 268 3.423154 CGGAGCGTTGAACTGGGC 61.423 66.667 0.00 0.00 0.00 5.36
328 352 3.535561 ACACCATCGAAGACCATGATTC 58.464 45.455 0.00 0.00 42.51 2.52
555 580 7.257722 TGATTTCTTCTTGTGTTTTCTGGTTC 58.742 34.615 0.00 0.00 0.00 3.62
578 603 8.995220 GTTCATTGTAGGAAACATTGTGTAGTA 58.005 33.333 0.00 0.00 39.44 1.82
679 704 6.322456 TCTCATGTTTGTTTACAAATGGGACA 59.678 34.615 10.87 5.61 46.12 4.02
738 765 7.093992 ACTCTCTAAATAAGTTGTCTGCAGAC 58.906 38.462 35.04 35.04 44.97 3.51
945 972 7.386299 ACTTTATTATATTCCAGAGCTTCTGCG 59.614 37.037 7.44 2.93 42.98 5.18
1016 1045 1.639298 GGCATGAACTGTGGAGTCGC 61.639 60.000 0.00 0.00 0.00 5.19
1375 1405 3.563390 GGTGCATAAGCTGAAGGAGAATC 59.437 47.826 0.00 0.00 42.74 2.52
1604 1634 1.006102 GAGGGTGTGTGACGGTCTG 60.006 63.158 9.88 0.00 0.00 3.51
1721 1751 4.494091 ACTGTAATCTAGCAAGGCACAT 57.506 40.909 0.00 0.00 0.00 3.21
1776 1806 0.814010 GGTGACGTGGCACTGACTTT 60.814 55.000 16.72 0.00 38.78 2.66
1877 1907 0.613260 TACTCCTGAAGCCAACGCAT 59.387 50.000 0.00 0.00 37.52 4.73
2145 2175 4.126437 CAAATGTTTTTGTTCCCTGGTCC 58.874 43.478 0.00 0.00 37.92 4.46
2295 2325 3.744426 GCCACGTTTAGACATAACACAGT 59.256 43.478 0.00 0.00 0.00 3.55
2329 2359 5.119588 GCGCAACAACATCTAACTGTACTAA 59.880 40.000 0.30 0.00 0.00 2.24
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
7 8 1.218316 GGCGAGGGACTTCGACATT 59.782 57.895 8.06 0.00 41.55 2.71
63 86 2.039418 TCGAGAGGAGAGAGAGAGAGG 58.961 57.143 0.00 0.00 0.00 3.69
328 352 1.004560 TCGAGCTCTTTGCCACAGG 60.005 57.895 12.85 0.00 44.23 4.00
555 580 8.547967 AGTACTACACAATGTTTCCTACAATG 57.452 34.615 0.00 0.00 42.27 2.82
738 765 5.050499 CAGCTTGAATTAATCTGGAGCTACG 60.050 44.000 12.39 0.00 37.39 3.51
848 875 2.728690 TGCAATGTGGCACTTCAATC 57.271 45.000 19.83 3.96 39.25 2.67
1016 1045 3.131478 GGCGGTCAACCCATTCGG 61.131 66.667 0.00 0.00 37.81 4.30
1375 1405 2.096268 TGACGCTTTGCATCTTCTTTCG 60.096 45.455 0.00 0.00 0.00 3.46
1721 1751 0.394216 ATGCCTGCCAAAGCGACATA 60.394 50.000 0.00 0.00 44.31 2.29
1776 1806 1.349688 ACATAGGACCGTGCCTTTGAA 59.650 47.619 14.91 0.00 38.73 2.69
1877 1907 2.942796 AATCGAGTCGGCACTGGCA 61.943 57.895 13.54 0.00 43.71 4.92
2034 2064 2.421314 CAGTGACCAGACGGCACA 59.579 61.111 0.00 0.00 40.03 4.57
2094 2124 3.132084 GCACTGCCTTGCCTGTTT 58.868 55.556 0.00 0.00 36.42 2.83
2145 2175 0.516877 AACATTCGTGTGCGGTCATG 59.483 50.000 0.00 0.00 38.89 3.07
2229 2259 8.741101 TTTGTAAGCTTGTTATAACAATGCTG 57.259 30.769 32.46 22.91 46.71 4.41
2295 2325 2.431454 TGTTGTTGCGCCAATCTGATA 58.569 42.857 4.18 0.00 0.00 2.15
2329 2359 6.270231 ACAGGATTGTAGTTAGTTCCTCAAGT 59.730 38.462 0.00 0.00 34.59 3.16
2436 2467 4.579340 CCATCTCAAGTTATCAGCATGCTT 59.421 41.667 19.98 7.40 34.76 3.91


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.