Multiple sequence alignment - TraesCS4D01G320800

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G320800 chr4D 100.000 2378 0 0 1 2378 483696760 483699137 0 4392
1 TraesCS4D01G320800 chr4D 97.397 2382 54 6 1 2378 135005820 135003443 0 4048
2 TraesCS4D01G320800 chr4D 96.348 2382 80 5 1 2378 241142844 241140466 0 3910
3 TraesCS4D01G320800 chr5D 96.222 2382 83 5 1 2378 79865656 79868034 0 3893
4 TraesCS4D01G320800 chr5D 94.286 2380 121 12 4 2378 197839494 197837125 0 3627
5 TraesCS4D01G320800 chr1B 95.886 2382 80 7 1 2378 286167001 286169368 0 3840
6 TraesCS4D01G320800 chr1B 95.897 2023 78 4 360 2378 286025634 286023613 0 3271
7 TraesCS4D01G320800 chr7A 95.892 2191 82 4 194 2378 571648029 571650217 0 3541
8 TraesCS4D01G320800 chr6B 96.027 1636 48 5 1 1627 53079408 53081035 0 2645
9 TraesCS4D01G320800 chr3A 98.198 1498 26 1 1 1497 191855950 191857447 0 2615
10 TraesCS4D01G320800 chr1D 97.946 1217 20 2 1165 2378 185763599 185764813 0 2104
11 TraesCS4D01G320800 chr6A 98.915 922 7 1 1460 2378 289123072 289123993 0 1644


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G320800 chr4D 483696760 483699137 2377 False 4392 4392 100.000 1 2378 1 chr4D.!!$F1 2377
1 TraesCS4D01G320800 chr4D 135003443 135005820 2377 True 4048 4048 97.397 1 2378 1 chr4D.!!$R1 2377
2 TraesCS4D01G320800 chr4D 241140466 241142844 2378 True 3910 3910 96.348 1 2378 1 chr4D.!!$R2 2377
3 TraesCS4D01G320800 chr5D 79865656 79868034 2378 False 3893 3893 96.222 1 2378 1 chr5D.!!$F1 2377
4 TraesCS4D01G320800 chr5D 197837125 197839494 2369 True 3627 3627 94.286 4 2378 1 chr5D.!!$R1 2374
5 TraesCS4D01G320800 chr1B 286167001 286169368 2367 False 3840 3840 95.886 1 2378 1 chr1B.!!$F1 2377
6 TraesCS4D01G320800 chr1B 286023613 286025634 2021 True 3271 3271 95.897 360 2378 1 chr1B.!!$R1 2018
7 TraesCS4D01G320800 chr7A 571648029 571650217 2188 False 3541 3541 95.892 194 2378 1 chr7A.!!$F1 2184
8 TraesCS4D01G320800 chr6B 53079408 53081035 1627 False 2645 2645 96.027 1 1627 1 chr6B.!!$F1 1626
9 TraesCS4D01G320800 chr3A 191855950 191857447 1497 False 2615 2615 98.198 1 1497 1 chr3A.!!$F1 1496
10 TraesCS4D01G320800 chr1D 185763599 185764813 1214 False 2104 2104 97.946 1165 2378 1 chr1D.!!$F1 1213
11 TraesCS4D01G320800 chr6A 289123072 289123993 921 False 1644 1644 98.915 1460 2378 1 chr6A.!!$F1 918

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
667 678 4.929808 GCTAGTTTCTTTGATTCCACTCGA 59.07 41.667 0.0 0.0 0.0 4.04 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1629 1643 0.541863 CTTTGGTAGCACTCGGGGAT 59.458 55.0 0.0 0.0 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 133 5.063564 GGCGAAATTACGTGAGAGAAAGAAT 59.936 40.000 0.00 0.00 35.59 2.40
667 678 4.929808 GCTAGTTTCTTTGATTCCACTCGA 59.070 41.667 0.00 0.00 0.00 4.04
1432 1446 1.150536 GGGGGCGATATGGAAGCAA 59.849 57.895 0.00 0.00 0.00 3.91
1909 1923 0.104672 TTCCCACCTCTGACCTTCCA 60.105 55.000 0.00 0.00 0.00 3.53
2068 2082 4.659172 TCTTGGTTGCGGGGCCAG 62.659 66.667 4.39 1.12 36.00 4.85
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
103 104 2.104253 CACGTAATTTCGCCCGCCT 61.104 57.895 4.22 0.00 0.00 5.52
132 133 1.410517 GCGGACTCCATCAATCTGAGA 59.589 52.381 0.00 0.00 0.00 3.27
486 495 4.398319 GAACCACTGAAGGATTTCAAGGA 58.602 43.478 12.56 0.00 42.48 3.36
562 573 1.021920 TCTCTCGCTCTCCTCGTGTG 61.022 60.000 0.00 0.00 0.00 3.82
563 574 0.321741 TTCTCTCGCTCTCCTCGTGT 60.322 55.000 0.00 0.00 0.00 4.49
565 576 0.321741 TGTTCTCTCGCTCTCCTCGT 60.322 55.000 0.00 0.00 0.00 4.18
667 678 4.347583 TGGAAGCAAATGGAAAAGGAACAT 59.652 37.500 0.00 0.00 0.00 2.71
807 818 3.383162 AGGTGACTTCCGGATCAGT 57.617 52.632 4.15 6.77 37.44 3.41
1432 1446 4.344390 CGTAATAAGGGAAAGGGAGCTAGT 59.656 45.833 0.00 0.00 0.00 2.57
1629 1643 0.541863 CTTTGGTAGCACTCGGGGAT 59.458 55.000 0.00 0.00 0.00 3.85
1909 1923 3.445008 AGTGGACTGGTCATGTCATAGT 58.555 45.455 3.10 0.00 36.26 2.12


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.