Multiple sequence alignment - TraesCS4D01G320700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G320700 chr4D 100.000 2286 0 0 1 2286 483696360 483698645 0 4222
1 TraesCS4D01G320700 chr4D 97.464 2287 54 4 1 2286 135006220 135003937 0 3899
2 TraesCS4D01G320700 chr4D 96.633 2287 74 3 1 2286 241143244 241140960 0 3794
3 TraesCS4D01G320700 chr5D 96.147 2284 85 3 1 2283 79865256 79867537 0 3727
4 TraesCS4D01G320700 chr5D 94.626 2289 115 7 2 2286 197839898 197837614 0 3539
5 TraesCS4D01G320700 chr7D 98.673 1884 24 1 1 1883 579015579 579017462 0 3339
6 TraesCS4D01G320700 chr7D 97.619 462 11 0 1825 2286 48839271 48839732 0 793
7 TraesCS4D01G320700 chrUn 98.567 1884 23 2 1 1883 237257829 237255949 0 3326
8 TraesCS4D01G320700 chr3A 98.314 1898 31 1 1 1897 191855550 191857447 0 3326
9 TraesCS4D01G320700 chr1A 98.514 1884 27 1 1 1883 238155129 238153246 0 3323
10 TraesCS4D01G320700 chr6B 96.124 2038 58 10 1 2027 53079008 53081035 0 3306
11 TraesCS4D01G320700 chr1D 98.615 722 10 0 1565 2286 185763599 185764320 0 1279
12 TraesCS4D01G320700 chr5B 97.115 728 21 0 1559 2286 87747596 87748323 0 1229
13 TraesCS4D01G320700 chr3B 99.532 427 2 0 1860 2286 92194034 92194460 0 778
14 TraesCS4D01G320700 chr6A 99.297 427 3 0 1860 2286 289123072 289123498 0 773


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G320700 chr4D 483696360 483698645 2285 False 4222 4222 100.000 1 2286 1 chr4D.!!$F1 2285
1 TraesCS4D01G320700 chr4D 135003937 135006220 2283 True 3899 3899 97.464 1 2286 1 chr4D.!!$R1 2285
2 TraesCS4D01G320700 chr4D 241140960 241143244 2284 True 3794 3794 96.633 1 2286 1 chr4D.!!$R2 2285
3 TraesCS4D01G320700 chr5D 79865256 79867537 2281 False 3727 3727 96.147 1 2283 1 chr5D.!!$F1 2282
4 TraesCS4D01G320700 chr5D 197837614 197839898 2284 True 3539 3539 94.626 2 2286 1 chr5D.!!$R1 2284
5 TraesCS4D01G320700 chr7D 579015579 579017462 1883 False 3339 3339 98.673 1 1883 1 chr7D.!!$F2 1882
6 TraesCS4D01G320700 chrUn 237255949 237257829 1880 True 3326 3326 98.567 1 1883 1 chrUn.!!$R1 1882
7 TraesCS4D01G320700 chr3A 191855550 191857447 1897 False 3326 3326 98.314 1 1897 1 chr3A.!!$F1 1896
8 TraesCS4D01G320700 chr1A 238153246 238155129 1883 True 3323 3323 98.514 1 1883 1 chr1A.!!$R1 1882
9 TraesCS4D01G320700 chr6B 53079008 53081035 2027 False 3306 3306 96.124 1 2027 1 chr6B.!!$F1 2026
10 TraesCS4D01G320700 chr1D 185763599 185764320 721 False 1279 1279 98.615 1565 2286 1 chr1D.!!$F1 721
11 TraesCS4D01G320700 chr5B 87747596 87748323 727 False 1229 1229 97.115 1559 2286 1 chr5B.!!$F1 727

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
984 996 0.321741 ACGAGGAGAGCGAGAGAACA 60.322 55.0 0.0 0.0 0.0 3.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2029 2047 0.541863 CTTTGGTAGCACTCGGGGAT 59.458 55.0 0.0 0.0 0.0 3.85 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
335 338 4.795268 CTCAGTAAAGAAGAGTACGTGCA 58.205 43.478 6.38 0.0 0.00 4.57
532 535 5.063564 GGCGAAATTACGTGAGAGAAAGAAT 59.936 40.000 0.00 0.0 35.59 2.40
984 996 0.321741 ACGAGGAGAGCGAGAGAACA 60.322 55.000 0.00 0.0 0.00 3.18
1067 1079 4.929808 GCTAGTTTCTTTGATTCCACTCGA 59.070 41.667 0.00 0.0 0.00 4.04
1375 1388 3.541996 ACCACTTTTGAAAGGGCAAAG 57.458 42.857 8.23 0.0 38.11 2.77
1832 1850 1.150536 GGGGGCGATATGGAAGCAA 59.849 57.895 0.00 0.0 0.00 3.91
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
503 506 2.104253 CACGTAATTTCGCCCGCCT 61.104 57.895 4.22 0.00 0.00 5.52
532 535 1.410517 GCGGACTCCATCAATCTGAGA 59.589 52.381 0.00 0.00 0.00 3.27
886 897 4.398319 GAACCACTGAAGGATTTCAAGGA 58.602 43.478 12.56 0.00 42.48 3.36
962 974 1.021920 TCTCTCGCTCTCCTCGTGTG 61.022 60.000 0.00 0.00 0.00 3.82
963 975 0.321741 TTCTCTCGCTCTCCTCGTGT 60.322 55.000 0.00 0.00 0.00 4.49
965 977 0.321741 TGTTCTCTCGCTCTCCTCGT 60.322 55.000 0.00 0.00 0.00 4.18
1067 1079 4.347583 TGGAAGCAAATGGAAAAGGAACAT 59.652 37.500 0.00 0.00 0.00 2.71
1207 1219 3.383162 AGGTGACTTCCGGATCAGT 57.617 52.632 4.15 6.77 37.44 3.41
1425 1439 4.636206 GCCGTTTTTCTTCTCTACCATGAT 59.364 41.667 0.00 0.00 0.00 2.45
1832 1850 4.344390 CGTAATAAGGGAAAGGGAGCTAGT 59.656 45.833 0.00 0.00 0.00 2.57
2029 2047 0.541863 CTTTGGTAGCACTCGGGGAT 59.458 55.000 0.00 0.00 0.00 3.85


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.