AutoCloner

Multiple sequence alignment - TraesCS4D01G315700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)

BLAST Results

Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

	qseqid	sseqid	percentage.identical	alignment.length	no.mismatch	no.gap.openings	qstart	qend	sstart	send	evalue	bitscore
0	TraesCS4D01G315700	chr4D	100.000	2813	0	0	1	2813	481172131	481174943	0.000000e+00	5195.0
1	TraesCS4D01G315700	chr4B	86.708	978	74	18	1784	2734	609504743	609505691	0.000000e+00	1035.0
2	TraesCS4D01G315700	chr4B	86.397	963	76	31	1	943	609502383	609503310	0.000000e+00	1002.0
3	TraesCS4D01G315700	chr4B	84.158	202	27	3	981	1177	609503319	609503520	1.030000e-44	191.0
4	TraesCS4D01G315700	chr4B	93.333	75	5	0	2739	2813	609505775	609505849	8.240000e-21	111.0
5	TraesCS4D01G315700	chr5A	89.157	415	25	4	627	1037	662334121	662333723	1.500000e-137	499.0
6	TraesCS4D01G315700	chr5A	88.272	324	28	5	319	632	662334515	662334192	2.050000e-101	379.0
7	TraesCS4D01G315700	chr5A	90.941	287	12	7	1	280	662334796	662334517	9.510000e-100	374.0
8	TraesCS4D01G315700	chr5A	91.139	237	15	2	2455	2686	662332261	662332026	1.630000e-82	316.0
9	TraesCS4D01G315700	chr5A	85.526	152	10	5	1088	1227	662333713	662333562	6.280000e-32	148.0
10	TraesCS4D01G315700	chr5A	98.649	74	1	0	1251	1324	662333487	662333414	6.320000e-27	132.0
11	TraesCS4D01G315700	chr5A	91.304	92	8	0	2722	2813	662332032	662331941	2.940000e-25	126.0
12	TraesCS4D01G315700	chr5A	87.838	74	6	1	2255	2325	662332403	662332330	1.800000e-12	84.2
13	TraesCS4D01G315700	chr2D	85.024	414	50	3	1387	1788	37246004	37246417	7.250000e-111	411.0
14	TraesCS4D01G315700	chr2A	86.686	338	45	0	1387	1724	42026843	42026506	2.650000e-100	375.0
15	TraesCS4D01G315700	chr2A	72.770	426	78	27	1223	1633	131711568	131711970	2.960000e-20	110.0
16	TraesCS4D01G315700	chr2A	90.476	42	4	0	2225	2266	712054193	712054152	3.910000e-04	56.5
17	TraesCS4D01G315700	chr2B	80.000	410	72	6	1387	1788	64807580	64807173	7.620000e-76	294.0
18	TraesCS4D01G315700	chr2B	92.424	132	10	0	1224	1355	64863939	64863808	3.700000e-44	189.0
19	TraesCS4D01G315700	chr1A	77.426	505	75	26	1226	1713	11530587	11531069	5.970000e-67	265.0
20	TraesCS4D01G315700	chr1A	81.319	91	16	1	2171	2261	419033839	419033928	3.890000e-09	73.1
21	TraesCS4D01G315700	chr1A	93.478	46	2	1	2217	2262	331272235	331272191	1.810000e-07	67.6
22	TraesCS4D01G315700	chr4A	80.347	173	31	2	1224	1394	742751305	742751476	8.180000e-26	128.0
23	TraesCS4D01G315700	chr4A	79.769	173	32	2	1224	1394	743383886	743384057	3.810000e-24	122.0
24	TraesCS4D01G315700	chr7D	84.127	126	20	0	1224	1349	2052555	2052680	3.810000e-24	122.0
25	TraesCS4D01G315700	chrUn	78.824	170	36	0	1225	1394	265076215	265076046	6.370000e-22	115.0
26	TraesCS4D01G315700	chr1D	82.418	91	15	1	2171	2261	325484579	325484490	8.350000e-11	78.7
27	TraesCS4D01G315700	chr1D	90.385	52	5	0	2209	2260	53260562	53260511	5.030000e-08	69.4
28	TraesCS4D01G315700	chr3B	93.750	48	3	0	2190	2237	756662939	756662986	3.890000e-09	73.1
29	TraesCS4D01G315700	chr1B	81.319	91	16	1	2171	2261	437599791	437599702	3.890000e-09	73.1
30	TraesCS4D01G315700	chr1B	93.478	46	2	1	2217	2262	355408309	355408265	1.810000e-07	67.6
31	TraesCS4D01G315700	chr3D	81.481	81	12	3	2172	2251	454901709	454901787	2.340000e-06	63.9

These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

	query	scaffold	start	end	length	rev.comp	avg.bitscore	max.bitscore	avg.percent.identical	query.start	query.end	num_hsp	groupid	homo_length
0	TraesCS4D01G315700	chr4D	481172131	481174943	2812	False	5195.000	5195	100.00000	1	2813	1	chr4D.!!$F1	2812
1	TraesCS4D01G315700	chr4B	609502383	609505849	3466	False	584.750	1035	87.64900	1	2813	4	chr4B.!!$F1	2812
2	TraesCS4D01G315700	chr5A	662331941	662334796	2855	True	257.275	499	90.35325	1	2813	8	chr5A.!!$R1	2812

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
739	842	0.179084	TGCATACGGCTAGGCTCAAC	60.179	55.0	15.11	0.77	45.15	3.18	F

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability	Orientation
2431	3486	0.039618	GAATGGCAGTGGGGAAGGAA	59.96	55.0	0.0	0.0	0.0	3.36	R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
54	56	4.689612	AAGGTCATGTCTTACTGTGTGT	57.310	40.909	0.00	0.00	0.00	3.72
85	87	6.229936	AGGCTAGTTTTCCATTATCACGTA	57.770	37.500	0.00	0.00	0.00	3.57
95	97	6.718522	TCCATTATCACGTACTCACCATAA	57.281	37.500	0.00	0.00	0.00	1.90
106	108	2.228822	ACTCACCATAAAGGCGCAAAAG	59.771	45.455	10.83	0.00	43.14	2.27
206	208	6.906659	TCTTATATTTCCGACGACCTACATC	58.093	40.000	0.00	0.00	0.00	3.06
215	222	4.980434	CCGACGACCTACATCGATAATTTT	59.020	41.667	0.00	0.00	45.13	1.82
298	305	3.072476	AGCAAGACTAAGTTAACCTGGCA	59.928	43.478	0.88	0.00	0.00	4.92
309	316	4.428845	CCTGGCAAGGCTGATGTT	57.571	55.556	0.00	0.00	36.56	2.71
313	320	1.246056	TGGCAAGGCTGATGTTGAGC	61.246	55.000	0.00	0.00	35.57	4.26
322	329	2.670414	GCTGATGTTGAGCTCACAGTAC	59.330	50.000	24.76	17.93	33.37	2.73
328	335	0.817654	TGAGCTCACAGTACGGATGG	59.182	55.000	13.74	0.00	0.00	3.51
390	397	3.431207	CCAGGTACGGTTGGTTATCGATT	60.431	47.826	1.71	0.00	0.00	3.34
397	404	4.400251	ACGGTTGGTTATCGATTCTCTGTA	59.600	41.667	1.71	0.00	0.00	2.74
478	486	8.158169	TGTGAATATGAAATCTTGTAGGATGC	57.842	34.615	0.00	0.00	0.00	3.91
529	537	2.785258	GAATGCGGTCTCGGTTGC	59.215	61.111	0.00	0.00	36.79	4.17
543	560	4.178169	TTGCCCACGGACACGGTT	62.178	61.111	0.00	0.00	46.48	4.44
544	561	4.612412	TGCCCACGGACACGGTTC	62.612	66.667	0.00	0.00	46.48	3.62
570	587	8.230486	CGTCTGTTGCTACTGATTTTATCTTTT	58.770	33.333	10.67	0.00	35.15	2.27
684	785	6.215845	GCTGTGGTTTGTTAGTGAATGAATT	58.784	36.000	0.00	0.00	0.00	2.17
703	804	5.822519	TGAATTGCTGTGGTCCATCTTATAC	59.177	40.000	0.00	0.00	0.00	1.47
716	819	4.510340	CCATCTTATACGCTGGTACCAAAC	59.490	45.833	17.11	10.23	0.00	2.93
730	833	0.881118	CCAAACTGTTGCATACGGCT	59.119	50.000	0.00	0.00	45.15	5.52
739	842	0.179084	TGCATACGGCTAGGCTCAAC	60.179	55.000	15.11	0.77	45.15	3.18
764	867	6.374565	TTGAGCCCAACAAATTGAAAAATG	57.625	33.333	0.00	0.00	38.15	2.32
801	904	4.155063	TGCACATTGGCACATATCTAGT	57.845	40.909	0.00	0.00	39.25	2.57

Showing 1 to 25 of 126 entries

Previous1 2 3 4 5 6Next

Show entries

Search:

Position	MSA Position	Penalty	Sequence	TM	GC	Self any TH	Self end TH	Hairpin	End Stability
20	22	6.226787	AGACATGACCTTACATATAGCTTGC	58.773	40.000	0.00	0.00	0.00	4.01
54	56	9.561069	GATAATGGAAAACTAGCCTTCATAAGA	57.439	33.333	6.71	0.00	0.00	2.10
95	97	4.513198	TGCTTATTAACTTTTGCGCCTT	57.487	36.364	4.18	0.00	0.00	4.35
106	108	7.876896	TTTTCCCGTTCAATTGCTTATTAAC	57.123	32.000	0.00	0.00	0.00	2.01
206	208	8.928270	ACCTCTAACTGACAGTAAAATTATCG	57.072	34.615	8.91	0.00	0.00	2.92
215	222	3.510360	GCCTCAACCTCTAACTGACAGTA	59.490	47.826	8.91	0.00	0.00	2.74
267	274	1.728971	CTTAGTCTTGCTCTGTTGCCG	59.271	52.381	0.00	0.00	0.00	5.69
298	305	1.072806	TGTGAGCTCAACATCAGCCTT	59.927	47.619	20.19	0.00	37.63	4.35
309	316	0.817654	CCATCCGTACTGTGAGCTCA	59.182	55.000	13.74	13.74	0.00	4.26
313	320	1.878522	GCGCCATCCGTACTGTGAG	60.879	63.158	0.00	0.00	39.71	3.51
415	422	4.712476	AGCAGATTTCATACTCACATCCC	58.288	43.478	0.00	0.00	0.00	3.85
458	466	7.083062	TCCAGCATCCTACAAGATTTCATAT	57.917	36.000	0.00	0.00	0.00	1.78
471	479	1.141657	GCAGTCCATTCCAGCATCCTA	59.858	52.381	0.00	0.00	0.00	2.94
478	486	0.393537	GTCAGGGCAGTCCATTCCAG	60.394	60.000	0.00	0.00	38.24	3.86
529	537	4.289245	ACGAACCGTGTCCGTGGG	62.289	66.667	0.00	0.00	39.18	4.61
534	542	1.828331	GCAACAGACGAACCGTGTCC	61.828	60.000	0.00	0.00	41.37	4.02
543	560	6.631016	AGATAAAATCAGTAGCAACAGACGA	58.369	36.000	0.00	0.00	0.00	4.20
544	561	6.893958	AGATAAAATCAGTAGCAACAGACG	57.106	37.500	0.00	0.00	0.00	4.18
570	587	6.339587	ACGGCAATCAGAAAGGAAAATAAA	57.660	33.333	0.00	0.00	0.00	1.40
684	785	2.483013	GCGTATAAGATGGACCACAGCA	60.483	50.000	0.00	0.00	38.15	4.41
703	804	0.040425	GCAACAGTTTGGTACCAGCG	60.040	55.000	15.65	7.48	32.81	5.18
716	819	0.179073	AGCCTAGCCGTATGCAACAG	60.179	55.000	0.00	0.00	44.83	3.16
739	842	6.434018	TTTTTCAATTTGTTGGGCTCAAAG	57.566	33.333	0.00	0.00	38.02	2.77
801	904	2.869636	GCCATTTCAAAATGAACGGCCA	60.870	45.455	15.35	0.00	46.72	5.36
863	969	7.153985	TCCACTTGAATGAAATGAAACCATTC	58.846	34.615	0.00	0.00	43.73	2.67

Showing 1 to 25 of 124 entries

Previous1 2 3 4 5Next

Based at the University of Bristol with support from BBSRC.

AutoCloner maintained by Alex Coulton.