Multiple sequence alignment - TraesCS4D01G305600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G305600 chr4D 100.000 2638 0 0 1 2638 473971222 473968585 0.000000e+00 4872
1 TraesCS4D01G305600 chr5D 95.815 1816 52 13 1 1800 387241778 387243585 0.000000e+00 2911
2 TraesCS4D01G305600 chr5D 95.412 850 28 5 1799 2638 223835866 223836714 0.000000e+00 1343
3 TraesCS4D01G305600 chr3D 95.299 1808 68 7 1 1793 558679302 558681107 0.000000e+00 2852
4 TraesCS4D01G305600 chr3D 95.529 850 27 6 1800 2638 363361546 363362395 0.000000e+00 1349
5 TraesCS4D01G305600 chr3D 95.406 849 27 5 1801 2638 29136833 29135986 0.000000e+00 1341
6 TraesCS4D01G305600 chr6B 94.972 1810 72 8 1 1793 147950688 147948881 0.000000e+00 2820
7 TraesCS4D01G305600 chr6B 94.377 1405 64 4 403 1793 717730829 717732232 0.000000e+00 2143
8 TraesCS4D01G305600 chr7B 94.868 1812 75 14 1 1800 36428067 36426262 0.000000e+00 2815
9 TraesCS4D01G305600 chr5B 94.275 1799 86 6 1 1784 529280455 529282251 0.000000e+00 2736
10 TraesCS4D01G305600 chr5B 95.150 1732 64 7 1 1717 659536139 659537865 0.000000e+00 2715
11 TraesCS4D01G305600 chr5B 95.316 1644 68 8 1 1640 649874493 649876131 0.000000e+00 2601
12 TraesCS4D01G305600 chr4B 93.975 1809 90 8 1 1793 622503281 622501476 0.000000e+00 2719
13 TraesCS4D01G305600 chr2B 94.003 1801 86 11 1 1784 664330485 664328690 0.000000e+00 2708
14 TraesCS4D01G305600 chr2B 94.076 996 45 4 811 1793 225324993 225323999 0.000000e+00 1500
15 TraesCS4D01G305600 chr1B 94.277 996 43 4 811 1793 359219908 359218914 0.000000e+00 1511
16 TraesCS4D01G305600 chr2D 95.765 850 24 5 1801 2638 507535589 507534740 0.000000e+00 1360
17 TraesCS4D01G305600 chr2D 95.406 849 27 7 1801 2638 376284975 376285822 0.000000e+00 1341
18 TraesCS4D01G305600 chr2D 95.316 854 25 10 1798 2638 489950387 489951238 0.000000e+00 1341
19 TraesCS4D01G305600 chr2D 95.401 848 28 5 1801 2638 27126750 27125904 0.000000e+00 1339
20 TraesCS4D01G305600 chr7D 95.221 858 30 4 1792 2638 108175208 108176065 0.000000e+00 1347
21 TraesCS4D01G305600 chr6D 95.289 849 27 6 1801 2638 60851732 60852578 0.000000e+00 1334
22 TraesCS4D01G305600 chr3B 92.791 430 19 2 1376 1793 10032856 10032427 1.740000e-171 612


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G305600 chr4D 473968585 473971222 2637 True 4872 4872 100.000 1 2638 1 chr4D.!!$R1 2637
1 TraesCS4D01G305600 chr5D 387241778 387243585 1807 False 2911 2911 95.815 1 1800 1 chr5D.!!$F2 1799
2 TraesCS4D01G305600 chr5D 223835866 223836714 848 False 1343 1343 95.412 1799 2638 1 chr5D.!!$F1 839
3 TraesCS4D01G305600 chr3D 558679302 558681107 1805 False 2852 2852 95.299 1 1793 1 chr3D.!!$F2 1792
4 TraesCS4D01G305600 chr3D 363361546 363362395 849 False 1349 1349 95.529 1800 2638 1 chr3D.!!$F1 838
5 TraesCS4D01G305600 chr3D 29135986 29136833 847 True 1341 1341 95.406 1801 2638 1 chr3D.!!$R1 837
6 TraesCS4D01G305600 chr6B 147948881 147950688 1807 True 2820 2820 94.972 1 1793 1 chr6B.!!$R1 1792
7 TraesCS4D01G305600 chr6B 717730829 717732232 1403 False 2143 2143 94.377 403 1793 1 chr6B.!!$F1 1390
8 TraesCS4D01G305600 chr7B 36426262 36428067 1805 True 2815 2815 94.868 1 1800 1 chr7B.!!$R1 1799
9 TraesCS4D01G305600 chr5B 529280455 529282251 1796 False 2736 2736 94.275 1 1784 1 chr5B.!!$F1 1783
10 TraesCS4D01G305600 chr5B 659536139 659537865 1726 False 2715 2715 95.150 1 1717 1 chr5B.!!$F3 1716
11 TraesCS4D01G305600 chr5B 649874493 649876131 1638 False 2601 2601 95.316 1 1640 1 chr5B.!!$F2 1639
12 TraesCS4D01G305600 chr4B 622501476 622503281 1805 True 2719 2719 93.975 1 1793 1 chr4B.!!$R1 1792
13 TraesCS4D01G305600 chr2B 664328690 664330485 1795 True 2708 2708 94.003 1 1784 1 chr2B.!!$R2 1783
14 TraesCS4D01G305600 chr2B 225323999 225324993 994 True 1500 1500 94.076 811 1793 1 chr2B.!!$R1 982
15 TraesCS4D01G305600 chr1B 359218914 359219908 994 True 1511 1511 94.277 811 1793 1 chr1B.!!$R1 982
16 TraesCS4D01G305600 chr2D 507534740 507535589 849 True 1360 1360 95.765 1801 2638 1 chr2D.!!$R2 837
17 TraesCS4D01G305600 chr2D 376284975 376285822 847 False 1341 1341 95.406 1801 2638 1 chr2D.!!$F1 837
18 TraesCS4D01G305600 chr2D 489950387 489951238 851 False 1341 1341 95.316 1798 2638 1 chr2D.!!$F2 840
19 TraesCS4D01G305600 chr2D 27125904 27126750 846 True 1339 1339 95.401 1801 2638 1 chr2D.!!$R1 837
20 TraesCS4D01G305600 chr7D 108175208 108176065 857 False 1347 1347 95.221 1792 2638 1 chr7D.!!$F1 846
21 TraesCS4D01G305600 chr6D 60851732 60852578 846 False 1334 1334 95.289 1801 2638 1 chr6D.!!$F1 837

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
601 608 0.108329 GGACAATGTGACGATCCGGT 60.108 55.0 0.0 0.0 0.0 5.28 F
1049 1057 1.354337 CCGTGTGCTGATCGTGAAGG 61.354 60.0 0.0 0.0 0.0 3.46 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1597 1609 0.320073 TCCCTTCTTGTAACGTGCCG 60.320 55.0 0.00 0.00 0.00 5.69 R
1982 2013 1.835494 AAGAATGTCATGCAGCTGCT 58.165 45.0 36.61 20.88 42.66 4.24 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
130 133 7.485595 CGCATCAACAAATCATTAGATTCAACA 59.514 33.333 0.00 0.00 43.52 3.33
157 160 5.762179 AGAAATGATCTACCAAGTGGACA 57.238 39.130 3.83 0.00 36.32 4.02
192 195 0.108804 CACGAGACGGTGTGGCTTAT 60.109 55.000 0.00 0.00 33.24 1.73
295 298 2.739849 TTTGATGACGGCGGCCAAGA 62.740 55.000 20.71 1.12 0.00 3.02
348 351 2.954753 GCGGTTGCAGGAGTTCACG 61.955 63.158 0.00 0.00 42.15 4.35
451 455 2.185310 ATCGTGCCTGACCCTGAACC 62.185 60.000 0.00 0.00 0.00 3.62
479 486 3.244911 TGCCTACAAAGGGAAGAAGAAGG 60.245 47.826 0.00 0.00 40.86 3.46
601 608 0.108329 GGACAATGTGACGATCCGGT 60.108 55.000 0.00 0.00 0.00 5.28
1049 1057 1.354337 CCGTGTGCTGATCGTGAAGG 61.354 60.000 0.00 0.00 0.00 3.46
1371 1382 7.360113 TGCAAGTACTTCACATGGATAGATA 57.640 36.000 4.77 0.00 0.00 1.98
1597 1609 1.307097 GATGCACAAGAGGAGGATGC 58.693 55.000 0.00 0.00 36.81 3.91
1640 1652 1.474330 GGCCCATGTTTCCTTAGTGG 58.526 55.000 0.00 0.00 37.10 4.00
1687 1710 6.914215 GTGACTGTTCGATGGTATTTCGTATA 59.086 38.462 0.00 0.00 37.82 1.47
2118 2151 3.379682 CGTTTCTCTCGTACACGCT 57.620 52.632 0.00 0.00 39.60 5.07
2122 2155 1.571215 TTCTCTCGTACACGCTCGCA 61.571 55.000 0.00 0.00 39.60 5.10
2141 2174 4.980805 GTGGGTGCGAGGCGTTGA 62.981 66.667 0.00 0.00 0.00 3.18
2237 2275 0.030773 CCGATCGAGCGATTCCTTCA 59.969 55.000 26.68 0.00 34.60 3.02
2247 2285 4.017808 AGCGATTCCTTCACTACTACTGT 58.982 43.478 0.00 0.00 0.00 3.55
2410 2451 0.920763 TGGGGCTGGATGAACAGGAT 60.921 55.000 0.00 0.00 38.90 3.24
2515 2558 0.991355 TGGAGGGGTGGTTGAACAGT 60.991 55.000 0.00 0.00 0.00 3.55
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
5 6 3.143728 GTGGTTTCGGAGCCTAAGAAAA 58.856 45.455 0.00 0.00 35.91 2.29
56 59 2.403252 ATCATCAACCTTGTCGGGAC 57.597 50.000 0.00 0.00 36.97 4.46
130 133 7.004086 TCCACTTGGTAGATCATTTCTTTGTT 58.996 34.615 0.00 0.00 35.79 2.83
192 195 0.741574 CCTTATACGCAACACCGCCA 60.742 55.000 0.00 0.00 0.00 5.69
348 351 0.534203 TCAACCTCGTGGCTTCCAAC 60.534 55.000 2.76 0.00 34.18 3.77
451 455 0.331278 TCCCTTTGTAGGCACCATGG 59.669 55.000 11.19 11.19 40.50 3.66
479 486 5.470047 TGTCACTCCTAAACCTCTTCTTC 57.530 43.478 0.00 0.00 0.00 2.87
601 608 4.006989 GGTGCATGTCCTAACATTGTGTA 58.993 43.478 0.00 0.00 43.74 2.90
1371 1382 4.916041 TGACATCCTCTGGAACATCTTT 57.084 40.909 0.00 0.00 38.20 2.52
1597 1609 0.320073 TCCCTTCTTGTAACGTGCCG 60.320 55.000 0.00 0.00 0.00 5.69
1640 1652 6.758416 TCACAGACATACATGCATCTAAAGAC 59.242 38.462 0.00 0.00 0.00 3.01
1687 1710 5.487433 TCGCAATATCATCAAATATCCGGT 58.513 37.500 0.00 0.00 0.00 5.28
1982 2013 1.835494 AAGAATGTCATGCAGCTGCT 58.165 45.000 36.61 20.88 42.66 4.24
2237 2275 4.763793 TCGGCTTCAGTTAACAGTAGTAGT 59.236 41.667 8.61 0.00 0.00 2.73
2247 2285 2.159099 AGCATCGATCGGCTTCAGTTAA 60.159 45.455 16.41 0.00 36.92 2.01


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.