Multiple sequence alignment - TraesCS4D01G304100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G304100 chr4D 100.000 5056 0 0 1 5056 472492245 472487190 0.000000e+00 9337.0
1 TraesCS4D01G304100 chr4D 81.765 861 66 32 3839 4631 30898232 30897395 1.990000e-178 636.0
2 TraesCS4D01G304100 chr4D 88.160 549 26 10 3226 3761 30898776 30898254 7.190000e-173 617.0
3 TraesCS4D01G304100 chr4D 92.218 257 15 2 4690 4946 30897396 30897145 4.810000e-95 359.0
4 TraesCS4D01G304100 chr4D 84.436 257 30 8 1513 1763 30903226 30902974 1.410000e-60 244.0
5 TraesCS4D01G304100 chr4D 95.327 107 3 2 4700 4804 449462815 449462709 8.710000e-38 169.0
6 TraesCS4D01G304100 chr4D 87.342 158 5 5 1314 1457 30921218 30921062 3.130000e-37 167.0
7 TraesCS4D01G304100 chr7D 98.795 5064 40 8 1 5056 78421276 78416226 0.000000e+00 8994.0
8 TraesCS4D01G304100 chr7D 96.117 103 4 0 4703 4805 413239439 413239337 8.710000e-38 169.0
9 TraesCS4D01G304100 chr7D 92.308 39 1 2 4299 4335 518683813 518683851 3.000000e-03 54.7
10 TraesCS4D01G304100 chr4B 88.492 2407 137 60 1033 3361 594848433 594846089 0.000000e+00 2782.0
11 TraesCS4D01G304100 chr4B 90.434 1129 70 21 3453 4550 594845950 594844829 0.000000e+00 1452.0
12 TraesCS4D01G304100 chr4B 88.723 470 30 10 528 981 594848901 594848439 2.060000e-153 553.0
13 TraesCS4D01G304100 chr4B 80.389 668 33 30 1 607 594849511 594848881 7.830000e-113 418.0
14 TraesCS4D01G304100 chr4B 85.824 261 22 7 4638 4895 594844824 594844576 3.880000e-66 263.0
15 TraesCS4D01G304100 chr4B 87.059 170 10 3 4888 5056 594844386 594844228 1.120000e-41 182.0
16 TraesCS4D01G304100 chr4B 96.226 106 2 2 4700 4804 562056597 562056493 6.730000e-39 172.0
17 TraesCS4D01G304100 chr4B 90.909 44 3 1 4293 4335 235385036 235385079 1.970000e-04 58.4
18 TraesCS4D01G304100 chr4A 90.550 1873 99 41 1032 2873 679259867 679258042 0.000000e+00 2407.0
19 TraesCS4D01G304100 chr4A 89.222 733 43 18 3361 4078 679257547 679256836 0.000000e+00 883.0
20 TraesCS4D01G304100 chr4A 82.801 564 41 27 1 532 679260839 679260300 2.150000e-123 453.0
21 TraesCS4D01G304100 chr4A 88.158 380 33 8 4675 5047 679256645 679256271 4.650000e-120 442.0
22 TraesCS4D01G304100 chr4A 86.636 434 17 17 568 968 679260304 679259879 4.650000e-120 442.0
23 TraesCS4D01G304100 chr4A 84.173 417 19 21 2870 3253 679258018 679257616 1.340000e-95 361.0
24 TraesCS4D01G304100 chr4A 93.805 113 3 3 4692 4804 17385845 17385953 3.130000e-37 167.0
25 TraesCS4D01G304100 chr4A 78.733 221 32 11 4336 4543 679256842 679256624 3.180000e-27 134.0
26 TraesCS4D01G304100 chr4A 90.909 44 3 1 4293 4335 242884792 242884835 1.970000e-04 58.4
27 TraesCS4D01G304100 chrUn 100.000 415 0 0 3903 4317 477287939 477288353 0.000000e+00 767.0
28 TraesCS4D01G304100 chrUn 96.875 32 1 0 4308 4339 317673522 317673553 3.000000e-03 54.7
29 TraesCS4D01G304100 chr5A 89.347 291 31 0 3464 3754 650649432 650649142 2.880000e-97 366.0
30 TraesCS4D01G304100 chr5A 92.857 42 1 1 4296 4335 644352318 644352359 5.470000e-05 60.2
31 TraesCS4D01G304100 chr5D 89.003 291 32 0 3464 3754 524449934 524449644 1.340000e-95 361.0
32 TraesCS4D01G304100 chr5D 100.000 31 0 0 4306 4336 449691991 449692021 1.970000e-04 58.4
33 TraesCS4D01G304100 chr5B 88.660 291 33 0 3464 3754 658925668 658925378 6.230000e-94 355.0
34 TraesCS4D01G304100 chr7B 97.087 103 3 0 4703 4805 427706909 427706807 1.870000e-39 174.0
35 TraesCS4D01G304100 chr1A 100.000 31 0 0 4305 4335 540054936 540054906 1.970000e-04 58.4
36 TraesCS4D01G304100 chr3B 87.500 48 4 1 4308 4355 63107201 63107156 3.000000e-03 54.7


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G304100 chr4D 472487190 472492245 5055 True 9337.000000 9337 100.000000 1 5056 1 chr4D.!!$R4 5055
1 TraesCS4D01G304100 chr4D 30897145 30898776 1631 True 537.333333 636 87.381000 3226 4946 3 chr4D.!!$R5 1720
2 TraesCS4D01G304100 chr7D 78416226 78421276 5050 True 8994.000000 8994 98.795000 1 5056 1 chr7D.!!$R1 5055
3 TraesCS4D01G304100 chr4B 594844228 594849511 5283 True 941.666667 2782 86.820167 1 5056 6 chr4B.!!$R2 5055
4 TraesCS4D01G304100 chr4A 679256271 679260839 4568 True 731.714286 2407 85.753286 1 5047 7 chr4A.!!$R1 5046

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
651 784 0.318762 CTATCCTTCCTAGGCGCCAC 59.681 60.000 31.54 1.27 41.69 5.01 F
1215 1408 4.254709 TGGCCAGCGAGTGCACTT 62.255 61.111 22.65 1.37 46.23 3.16 F
2555 2773 1.004918 AACCTCTCCGGCAACTTCG 60.005 57.895 0.00 0.00 35.61 3.79 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2241 2456 3.857038 GGATTAGCGGGCCGTCCA 61.857 66.667 28.82 11.78 34.36 4.02 R
3179 3504 2.417719 GTGAGAGCAAACATCCGAAGT 58.582 47.619 0.00 0.00 0.00 3.01 R
4348 4825 1.000771 TGGGCACTCGAGCTCTAGT 60.001 57.895 14.81 14.81 35.52 2.57 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
52 53 2.644992 CAAACACCTGCGCTTCCC 59.355 61.111 9.73 0.00 0.00 3.97
651 784 0.318762 CTATCCTTCCTAGGCGCCAC 59.681 60.000 31.54 1.27 41.69 5.01
1215 1408 4.254709 TGGCCAGCGAGTGCACTT 62.255 61.111 22.65 1.37 46.23 3.16
1834 2043 4.821589 GCCGGTAGCTTGCTCGCT 62.822 66.667 1.90 5.67 43.83 4.93
2555 2773 1.004918 AACCTCTCCGGCAACTTCG 60.005 57.895 0.00 0.00 35.61 3.79
3085 3384 4.981806 ATTCGTACACCCAAATTGATGG 57.018 40.909 0.00 0.00 40.35 3.51
3179 3504 4.937620 AGACATCTCGCATTCTGCTTTTTA 59.062 37.500 0.00 0.00 42.25 1.52
4851 5343 5.763204 TGTAAACTAAGGCTGAAAGGACAAG 59.237 40.000 0.00 0.00 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
132 169 4.373116 CCGACGTCACCCACCCAG 62.373 72.222 17.16 0.00 0.00 4.45
1215 1408 3.236047 TGGTAAAGAGCCTGTGTACAGA 58.764 45.455 13.36 0.00 46.59 3.41
2241 2456 3.857038 GGATTAGCGGGCCGTCCA 61.857 66.667 28.82 11.78 34.36 4.02
2555 2773 4.604776 CGTCGTATCGATTTACTTACCGAC 59.395 45.833 1.71 8.05 38.42 4.79
3179 3504 2.417719 GTGAGAGCAAACATCCGAAGT 58.582 47.619 0.00 0.00 0.00 3.01
4348 4825 1.000771 TGGGCACTCGAGCTCTAGT 60.001 57.895 14.81 14.81 35.52 2.57
4508 5000 9.823647 CTACCTCAGTAAAATAATGTCTGATGT 57.176 33.333 0.00 0.00 37.59 3.06
4851 5343 8.706322 ATATATGGTTTTTGGTATTCCTGTCC 57.294 34.615 0.00 0.00 34.23 4.02


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.