Multiple sequence alignment - TraesCS4D01G290200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G290200 chr4D 100.000 2608 0 0 1 2608 461410042 461407435 0.000000e+00 4817
1 TraesCS4D01G290200 chr4D 98.634 2050 28 0 559 2608 436827390 436829439 0.000000e+00 3631
2 TraesCS4D01G290200 chr4D 98.439 2050 32 0 559 2608 338462444 338464493 0.000000e+00 3609
3 TraesCS4D01G290200 chr5D 98.585 2050 29 0 559 2608 346024042 346026091 0.000000e+00 3626
4 TraesCS4D01G290200 chr2D 98.585 2050 29 0 559 2608 559268275 559270324 0.000000e+00 3626
5 TraesCS4D01G290200 chr6D 98.537 2050 30 0 559 2608 395491301 395493350 0.000000e+00 3620
6 TraesCS4D01G290200 chr6D 96.309 569 8 4 1 558 27923645 27923079 0.000000e+00 922
7 TraesCS4D01G290200 chr3D 98.537 2050 29 1 559 2608 84531336 84533384 0.000000e+00 3618
8 TraesCS4D01G290200 chr7D 98.488 2050 31 0 559 2608 52435198 52433149 0.000000e+00 3615
9 TraesCS4D01G290200 chr1D 98.489 2051 30 1 559 2608 447348668 447346618 0.000000e+00 3615
10 TraesCS4D01G290200 chr1D 98.441 2052 31 1 558 2608 419201036 419203087 0.000000e+00 3611
11 TraesCS4D01G290200 chr5A 90.925 573 28 6 1 560 549598516 549597955 0.000000e+00 749
12 TraesCS4D01G290200 chr4A 89.336 572 34 12 1 560 7846482 7845926 0.000000e+00 693
13 TraesCS4D01G290200 chr4A 83.536 577 49 25 4 558 498659104 498659656 5.010000e-137 497
14 TraesCS4D01G290200 chr1B 88.314 599 28 16 1 559 401335503 401334907 0.000000e+00 680
15 TraesCS4D01G290200 chr1B 87.960 598 30 16 1 558 269173107 269173702 0.000000e+00 667
16 TraesCS4D01G290200 chr1B 82.847 548 46 27 4 528 434080135 434079613 5.120000e-122 448
17 TraesCS4D01G290200 chr3B 87.950 556 37 9 1 528 118801929 118801376 1.700000e-176 628
18 TraesCS4D01G290200 chr2B 83.420 579 46 26 4 558 394123436 394122884 2.330000e-135 492
19 TraesCS4D01G290200 chr1A 83.507 576 44 26 4 558 530586736 530586191 8.390000e-135 490
20 TraesCS4D01G290200 chr4B 90.708 226 8 4 344 558 415228425 415228648 3.280000e-74 289


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G290200 chr4D 461407435 461410042 2607 True 4817 4817 100.000 1 2608 1 chr4D.!!$R1 2607
1 TraesCS4D01G290200 chr4D 436827390 436829439 2049 False 3631 3631 98.634 559 2608 1 chr4D.!!$F2 2049
2 TraesCS4D01G290200 chr4D 338462444 338464493 2049 False 3609 3609 98.439 559 2608 1 chr4D.!!$F1 2049
3 TraesCS4D01G290200 chr5D 346024042 346026091 2049 False 3626 3626 98.585 559 2608 1 chr5D.!!$F1 2049
4 TraesCS4D01G290200 chr2D 559268275 559270324 2049 False 3626 3626 98.585 559 2608 1 chr2D.!!$F1 2049
5 TraesCS4D01G290200 chr6D 395491301 395493350 2049 False 3620 3620 98.537 559 2608 1 chr6D.!!$F1 2049
6 TraesCS4D01G290200 chr6D 27923079 27923645 566 True 922 922 96.309 1 558 1 chr6D.!!$R1 557
7 TraesCS4D01G290200 chr3D 84531336 84533384 2048 False 3618 3618 98.537 559 2608 1 chr3D.!!$F1 2049
8 TraesCS4D01G290200 chr7D 52433149 52435198 2049 True 3615 3615 98.488 559 2608 1 chr7D.!!$R1 2049
9 TraesCS4D01G290200 chr1D 447346618 447348668 2050 True 3615 3615 98.489 559 2608 1 chr1D.!!$R1 2049
10 TraesCS4D01G290200 chr1D 419201036 419203087 2051 False 3611 3611 98.441 558 2608 1 chr1D.!!$F1 2050
11 TraesCS4D01G290200 chr5A 549597955 549598516 561 True 749 749 90.925 1 560 1 chr5A.!!$R1 559
12 TraesCS4D01G290200 chr4A 7845926 7846482 556 True 693 693 89.336 1 560 1 chr4A.!!$R1 559
13 TraesCS4D01G290200 chr4A 498659104 498659656 552 False 497 497 83.536 4 558 1 chr4A.!!$F1 554
14 TraesCS4D01G290200 chr1B 401334907 401335503 596 True 680 680 88.314 1 559 1 chr1B.!!$R1 558
15 TraesCS4D01G290200 chr1B 269173107 269173702 595 False 667 667 87.960 1 558 1 chr1B.!!$F1 557
16 TraesCS4D01G290200 chr1B 434079613 434080135 522 True 448 448 82.847 4 528 1 chr1B.!!$R2 524
17 TraesCS4D01G290200 chr3B 118801376 118801929 553 True 628 628 87.950 1 528 1 chr3B.!!$R1 527
18 TraesCS4D01G290200 chr2B 394122884 394123436 552 True 492 492 83.420 4 558 1 chr2B.!!$R1 554
19 TraesCS4D01G290200 chr1A 530586191 530586736 545 True 490 490 83.507 4 558 1 chr1A.!!$R1 554

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
715 804 4.385310 CCGGATTAAAAAGGTCTCCTCCAT 60.385 45.833 0.0 0.0 30.89 3.41 F
1172 1261 0.034896 GAGCGTGAGGAGTTTTCCCA 59.965 55.000 0.0 0.0 45.24 4.37 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1604 1693 2.158914 TGTGCCGTCTCATGATGCTTAT 60.159 45.455 0.0 0.0 0.00 1.73 R
2169 2259 2.549926 CTCCCAGTTTGCAACCAAAAC 58.450 47.619 0.0 0.0 42.19 2.43 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
479 567 6.973474 TGTAAACTGAAACCATAACCAAAACG 59.027 34.615 0.00 0.0 0.00 3.60
715 804 4.385310 CCGGATTAAAAAGGTCTCCTCCAT 60.385 45.833 0.00 0.0 30.89 3.41
1172 1261 0.034896 GAGCGTGAGGAGTTTTCCCA 59.965 55.000 0.00 0.0 45.24 4.37
1218 1307 8.771920 TTGAGATTGAAGAAAAGTATAAGCGA 57.228 30.769 0.00 0.0 0.00 4.93
1461 1550 0.036765 TGTTAGAAGCCCGTGCGATT 60.037 50.000 0.00 0.0 44.33 3.34
1604 1693 2.025898 TGTCGGCGATTGTATGTAGGA 58.974 47.619 14.79 0.0 0.00 2.94
1842 1931 0.399949 AGAGTCCCCAGTCACACCAA 60.400 55.000 0.00 0.0 0.00 3.67
1910 1999 0.987294 AATCCCCAGTCACTCCACAG 59.013 55.000 0.00 0.0 0.00 3.66
2069 2158 6.266330 TGTTAGTAGGGATGATGAGATGTCAG 59.734 42.308 0.00 0.0 35.66 3.51
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
160 177 0.753262 GGTCATACTCCGGTGCATCT 59.247 55.000 0.0 0.0 0.00 2.90
715 804 0.399091 ATCGAAGATGGGAGGAGCCA 60.399 55.000 0.0 0.0 45.12 4.75
1123 1212 2.829120 TCATCCTGTCCACGTATGAACA 59.171 45.455 0.0 0.0 0.00 3.18
1172 1261 2.036475 AGACGCATCTTCGCCATCTTAT 59.964 45.455 0.0 0.0 0.00 1.73
1218 1307 4.437682 TTTTTCCATGTCCTCACAGTCT 57.562 40.909 0.0 0.0 35.41 3.24
1604 1693 2.158914 TGTGCCGTCTCATGATGCTTAT 60.159 45.455 0.0 0.0 0.00 1.73
2069 2158 3.126831 CAAAGTATGCTCTCGGGACATC 58.873 50.000 4.0 0.0 0.00 3.06
2169 2259 2.549926 CTCCCAGTTTGCAACCAAAAC 58.450 47.619 0.0 0.0 42.19 2.43
2437 2527 8.170730 ACTTCCTGTAGAAAACCATAGGAATTT 58.829 33.333 0.0 0.0 41.81 1.82


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.