Multiple sequence alignment - TraesCS4D01G279600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G279600 chr4D 100.000 2243 0 0 1 2243 450898192 450895950 0 4143
1 TraesCS4D01G279600 chr4D 95.322 1133 42 9 616 1738 123350729 123351860 0 1788
2 TraesCS4D01G279600 chr4D 94.881 1133 47 9 616 1738 123561667 123562798 0 1760
3 TraesCS4D01G279600 chr4D 94.361 1135 51 7 616 1738 134980031 134981164 0 1729
4 TraesCS4D01G279600 chr4D 93.865 1141 55 9 616 1747 240994169 240993035 0 1705
5 TraesCS4D01G279600 chr4D 97.115 624 17 1 1 624 123350086 123350708 0 1051
6 TraesCS4D01G279600 chr3D 93.875 1649 74 15 616 2243 308558046 308556404 0 2460
7 TraesCS4D01G279600 chr3D 94.626 856 38 6 1394 2243 399731283 399732136 0 1319
8 TraesCS4D01G279600 chr7B 92.688 1436 73 18 1 1406 247473079 247474512 0 2041
9 TraesCS4D01G279600 chr7B 97.276 624 16 1 1 624 742948773 742948151 0 1057
10 TraesCS4D01G279600 chr5D 94.872 1131 47 9 616 1738 301055007 301056134 0 1757
11 TraesCS4D01G279600 chr6D 94.700 1132 49 7 616 1738 370023112 370024241 0 1748
12 TraesCS4D01G279600 chr1D 94.123 1140 56 7 616 1747 269426156 269425020 0 1724
13 TraesCS4D01G279600 chr1D 97.596 624 14 1 1 624 204063205 204063827 0 1068
14 TraesCS4D01G279600 chr1D 97.276 624 16 1 1 624 185743797 185743175 0 1057
15 TraesCS4D01G279600 chr6B 94.013 952 45 6 1302 2243 606986076 606987025 0 1432
16 TraesCS4D01G279600 chr7A 97.436 624 15 1 1 624 60084901 60085523 0 1062
17 TraesCS4D01G279600 chr7A 97.276 624 16 1 1 624 60168802 60168180 0 1057
18 TraesCS4D01G279600 chr5A 97.436 624 15 1 1 624 16544519 16545141 0 1062
19 TraesCS4D01G279600 chr2A 97.436 624 15 1 1 624 755480514 755481136 0 1062
20 TraesCS4D01G279600 chrUn 97.276 624 16 1 1 624 378556504 378557126 0 1057
21 TraesCS4D01G279600 chr2D 94.422 502 22 6 1745 2243 39668458 39668956 0 767
22 TraesCS4D01G279600 chr3B 90.758 541 38 6 1711 2240 669906729 669907268 0 712
23 TraesCS4D01G279600 chr2B 82.788 825 111 21 1440 2240 357335119 357335936 0 708
24 TraesCS4D01G279600 chr2B 82.878 806 108 20 1458 2240 526492586 526491788 0 697
25 TraesCS4D01G279600 chr2B 89.444 540 47 8 1711 2240 391176778 391177317 0 673
26 TraesCS4D01G279600 chr6A 89.630 540 46 7 1711 2240 597223673 597224212 0 678


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G279600 chr4D 450895950 450898192 2242 True 4143.0 4143 100.0000 1 2243 1 chr4D.!!$R2 2242
1 TraesCS4D01G279600 chr4D 123561667 123562798 1131 False 1760.0 1760 94.8810 616 1738 1 chr4D.!!$F1 1122
2 TraesCS4D01G279600 chr4D 134980031 134981164 1133 False 1729.0 1729 94.3610 616 1738 1 chr4D.!!$F2 1122
3 TraesCS4D01G279600 chr4D 240993035 240994169 1134 True 1705.0 1705 93.8650 616 1747 1 chr4D.!!$R1 1131
4 TraesCS4D01G279600 chr4D 123350086 123351860 1774 False 1419.5 1788 96.2185 1 1738 2 chr4D.!!$F3 1737
5 TraesCS4D01G279600 chr3D 308556404 308558046 1642 True 2460.0 2460 93.8750 616 2243 1 chr3D.!!$R1 1627
6 TraesCS4D01G279600 chr3D 399731283 399732136 853 False 1319.0 1319 94.6260 1394 2243 1 chr3D.!!$F1 849
7 TraesCS4D01G279600 chr7B 247473079 247474512 1433 False 2041.0 2041 92.6880 1 1406 1 chr7B.!!$F1 1405
8 TraesCS4D01G279600 chr7B 742948151 742948773 622 True 1057.0 1057 97.2760 1 624 1 chr7B.!!$R1 623
9 TraesCS4D01G279600 chr5D 301055007 301056134 1127 False 1757.0 1757 94.8720 616 1738 1 chr5D.!!$F1 1122
10 TraesCS4D01G279600 chr6D 370023112 370024241 1129 False 1748.0 1748 94.7000 616 1738 1 chr6D.!!$F1 1122
11 TraesCS4D01G279600 chr1D 269425020 269426156 1136 True 1724.0 1724 94.1230 616 1747 1 chr1D.!!$R2 1131
12 TraesCS4D01G279600 chr1D 204063205 204063827 622 False 1068.0 1068 97.5960 1 624 1 chr1D.!!$F1 623
13 TraesCS4D01G279600 chr1D 185743175 185743797 622 True 1057.0 1057 97.2760 1 624 1 chr1D.!!$R1 623
14 TraesCS4D01G279600 chr6B 606986076 606987025 949 False 1432.0 1432 94.0130 1302 2243 1 chr6B.!!$F1 941
15 TraesCS4D01G279600 chr7A 60084901 60085523 622 False 1062.0 1062 97.4360 1 624 1 chr7A.!!$F1 623
16 TraesCS4D01G279600 chr7A 60168180 60168802 622 True 1057.0 1057 97.2760 1 624 1 chr7A.!!$R1 623
17 TraesCS4D01G279600 chr5A 16544519 16545141 622 False 1062.0 1062 97.4360 1 624 1 chr5A.!!$F1 623
18 TraesCS4D01G279600 chr2A 755480514 755481136 622 False 1062.0 1062 97.4360 1 624 1 chr2A.!!$F1 623
19 TraesCS4D01G279600 chrUn 378556504 378557126 622 False 1057.0 1057 97.2760 1 624 1 chrUn.!!$F1 623
20 TraesCS4D01G279600 chr3B 669906729 669907268 539 False 712.0 712 90.7580 1711 2240 1 chr3B.!!$F1 529
21 TraesCS4D01G279600 chr2B 357335119 357335936 817 False 708.0 708 82.7880 1440 2240 1 chr2B.!!$F1 800
22 TraesCS4D01G279600 chr2B 526491788 526492586 798 True 697.0 697 82.8780 1458 2240 1 chr2B.!!$R1 782
23 TraesCS4D01G279600 chr2B 391176778 391177317 539 False 673.0 673 89.4440 1711 2240 1 chr2B.!!$F2 529
24 TraesCS4D01G279600 chr6A 597223673 597224212 539 False 678.0 678 89.6300 1711 2240 1 chr6A.!!$F1 529

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
407 411 2.133281 ATGCTGCTGTCAATGGCTTA 57.867 45.0 0.0 0.0 0.0 3.09 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1845 1922 0.032515 TTCCTGATCCTGAGCCGGTA 60.033 55.0 1.9 0.0 0.0 4.02 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
127 128 6.545666 TGTTTGGAAACAGAGCTCTTTTATCA 59.454 34.615 15.27 12.79 43.45 2.15
233 234 4.023536 TGCGGTAGTTCAAAACTGGAATTC 60.024 41.667 0.00 0.00 42.84 2.17
401 405 5.047872 TGTTGTGATTTATGCTGCTGTCAAT 60.048 36.000 0.00 0.00 0.00 2.57
407 411 2.133281 ATGCTGCTGTCAATGGCTTA 57.867 45.000 0.00 0.00 0.00 3.09
520 524 5.428496 AAAGGTGGCTTAACTAACGAAAC 57.572 39.130 0.00 0.00 0.00 2.78
620 624 5.045012 TCGTAGATGTAGGAAGAAGGCTA 57.955 43.478 0.00 0.00 0.00 3.93
793 839 8.630091 ACCTATACCTATACCTGATGATTACCA 58.370 37.037 0.00 0.00 0.00 3.25
818 864 7.959658 ATACCTGATGATTTTCAATCCACAA 57.040 32.000 0.00 0.00 0.00 3.33
919 965 3.364549 TGAAAATTATGGAGGTGCAGGG 58.635 45.455 0.00 0.00 0.00 4.45
1013 1065 5.723672 TTTCTCGAGATGTTAGAAGGTGT 57.276 39.130 17.44 0.00 31.30 4.16
1106 1158 4.216257 CAGTTCTTTGATTCATTCCGTGGT 59.784 41.667 0.00 0.00 0.00 4.16
1109 1161 1.902938 TTGATTCATTCCGTGGTGCA 58.097 45.000 0.00 0.00 0.00 4.57
1166 1218 2.235402 CCATTTTGGGCTTTGCTCTCAT 59.765 45.455 0.00 0.00 32.67 2.90
1178 1230 3.808466 TGCTCTCATCGAAGCTATTGT 57.192 42.857 8.21 0.00 0.00 2.71
1221 1273 6.211986 TGGCCTTTCTGATCTCATTCATTTTT 59.788 34.615 3.32 0.00 0.00 1.94
1247 1299 5.991328 TCGCATAAAAAGTCATGAGATCC 57.009 39.130 0.00 0.00 0.00 3.36
1259 1312 8.868522 AAGTCATGAGATCCAAAAGAAATGTA 57.131 30.769 0.00 0.00 0.00 2.29
1408 1463 3.073946 CACTTTTGAAAGGGTAGAGGGGA 59.926 47.826 8.23 0.00 40.31 4.81
1562 1623 5.671463 AGTAGTAGATCCCTCCTTGATCA 57.329 43.478 0.00 0.00 40.87 2.92
1748 1819 1.892474 GGCAGGAAACATACAAAGCCA 59.108 47.619 0.00 0.00 40.50 4.75
1845 1922 7.168905 CCTCCTTTAACTATTGACTTGAACCT 58.831 38.462 0.00 0.00 0.00 3.50
1867 1944 0.103937 CGGCTCAGGATCAGGAAGAC 59.896 60.000 0.00 0.00 0.00 3.01
1880 1957 7.459125 AGGATCAGGAAGACATTAGGCAATATA 59.541 37.037 0.00 0.00 0.00 0.86
1971 2048 4.633126 CCCGCTCTATGATCAATTATGTGG 59.367 45.833 0.00 5.68 0.00 4.17
2042 2119 5.364778 TCTCGGAGAACTTTCATTCAACAA 58.635 37.500 4.96 0.00 34.09 2.83
2043 2120 5.997746 TCTCGGAGAACTTTCATTCAACAAT 59.002 36.000 4.96 0.00 34.09 2.71
2179 2258 8.479280 CGAACTACAACAAAATGAAAATCAAGG 58.521 33.333 0.00 0.00 0.00 3.61
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
42 43 0.471191 TAGGCCGATACGTCTCCAGA 59.529 55.000 0.00 0.00 0.00 3.86
127 128 6.827727 ACGTTAATAGCTGGTCTAATTCCAT 58.172 36.000 0.00 0.00 34.26 3.41
262 266 4.387026 TCAAGGTCTGACCCAAATTGAT 57.613 40.909 22.81 0.00 39.75 2.57
401 405 2.221169 GGCATTCGATCACATAAGCCA 58.779 47.619 0.00 0.00 40.50 4.75
407 411 3.132824 TGTCTAGTGGCATTCGATCACAT 59.867 43.478 0.00 0.00 34.17 3.21
520 524 4.367386 GAAGCATCTGGTTCCATCTTTG 57.633 45.455 10.30 0.00 44.29 2.77
793 839 7.959658 TGTGGATTGAAAATCATCAGGTATT 57.040 32.000 2.66 0.00 0.00 1.89
818 864 8.025445 GCTTGTCACATATTCAAGAAAATGAGT 58.975 33.333 8.08 0.00 40.35 3.41
919 965 4.391830 TGTTGATGATTCGAAGTACTTGGC 59.608 41.667 14.14 0.00 0.00 4.52
1013 1065 3.118038 AGCTCCGGCACCTATTGATTTAA 60.118 43.478 0.00 0.00 41.70 1.52
1106 1158 5.177326 GTTTAGCCAATGATGGATTTTGCA 58.823 37.500 0.00 0.00 44.90 4.08
1109 1161 7.622713 TGATTGTTTAGCCAATGATGGATTTT 58.377 30.769 0.00 0.00 44.90 1.82
1166 1218 4.095782 GGGCAAACAATACAATAGCTTCGA 59.904 41.667 0.00 0.00 0.00 3.71
1221 1273 5.348164 TCTCATGACTTTTTATGCGATCGA 58.652 37.500 21.57 4.34 0.00 3.59
1288 1343 6.549736 TCATGGACCAAGAGAACGAGATATTA 59.450 38.462 0.00 0.00 0.00 0.98
1423 1480 1.006086 TTTCGTGCCATATGTCGCTG 58.994 50.000 1.24 0.00 0.00 5.18
1562 1623 3.683847 GCTTGCCTAACCTGATCTGTCAT 60.684 47.826 0.00 0.00 32.98 3.06
1748 1819 5.660460 TGATAGCATTAGATGAACGTGTGT 58.340 37.500 0.00 0.00 0.00 3.72
1845 1922 0.032515 TTCCTGATCCTGAGCCGGTA 60.033 55.000 1.90 0.00 0.00 4.02
1867 1944 8.731275 TTATGGATTCGGTATATTGCCTAATG 57.269 34.615 2.06 0.00 0.00 1.90
1971 2048 0.312416 ATCAGCATCTCCGACGTAGC 59.688 55.000 0.00 0.00 0.00 3.58
1998 2075 5.897050 AGATCTCTCGGATACACTTGTTTC 58.103 41.667 0.00 0.00 34.33 2.78
2042 2119 4.704540 TGACGAAATCAATTAACCCAGCAT 59.295 37.500 0.00 0.00 33.02 3.79
2043 2120 4.075682 TGACGAAATCAATTAACCCAGCA 58.924 39.130 0.00 0.00 33.02 4.41
2179 2258 1.494721 TGGCTACCATTCATTCCTCCC 59.505 52.381 0.00 0.00 0.00 4.30


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.