Multiple sequence alignment - TraesCS4D01G278900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G278900 chr4D 100.000 2369 0 0 1 2369 450210895 450213263 0.000000e+00 4375
1 TraesCS4D01G278900 chr3A 96.723 1373 40 5 1 1371 33835456 33836825 0.000000e+00 2281
2 TraesCS4D01G278900 chr3A 96.500 1057 31 5 1 1056 120238191 120239242 0.000000e+00 1742
3 TraesCS4D01G278900 chr3A 97.305 1002 26 1 1368 2369 120245530 120246530 0.000000e+00 1700
4 TraesCS4D01G278900 chr3A 97.006 1002 29 1 1368 2369 33842849 33843849 0.000000e+00 1683
5 TraesCS4D01G278900 chr3A 94.611 1002 54 0 1368 2369 21084407 21083406 0.000000e+00 1552
6 TraesCS4D01G278900 chr3A 96.885 642 18 2 1 642 40153733 40153094 0.000000e+00 1074
7 TraesCS4D01G278900 chr3A 94.774 287 15 0 1085 1371 120239232 120239518 4.640000e-122 448
8 TraesCS4D01G278900 chr6A 96.213 1373 43 9 1 1371 85543440 85544805 0.000000e+00 2239
9 TraesCS4D01G278900 chr6A 96.407 1002 36 0 1368 2369 85550829 85551830 0.000000e+00 1652
10 TraesCS4D01G278900 chr6A 91.743 218 18 0 996 1213 61397019 61396802 1.060000e-78 303
11 TraesCS4D01G278900 chr3D 96.215 1374 29 4 1 1371 592964801 592966154 0.000000e+00 2228
12 TraesCS4D01G278900 chr4A 95.408 1372 43 6 1 1371 374574321 374575673 0.000000e+00 2167
13 TraesCS4D01G278900 chr1B 91.744 1393 71 15 1 1371 127295917 127294547 0.000000e+00 1895
14 TraesCS4D01G278900 chr1B 88.983 236 24 1 996 1231 608360087 608360320 8.280000e-75 291
15 TraesCS4D01G278900 chr2B 97.505 1002 24 1 1368 2369 190035163 190034163 0.000000e+00 1711
16 TraesCS4D01G278900 chr2B 95.541 785 26 8 1 784 190042601 190041825 0.000000e+00 1247
17 TraesCS4D01G278900 chr2B 97.079 582 17 0 790 1371 190041779 190041198 0.000000e+00 981
18 TraesCS4D01G278900 chr6B 94.294 999 57 0 1368 2366 657199977 657200975 0.000000e+00 1530
19 TraesCS4D01G278900 chr6D 88.212 1018 92 15 1368 2363 226588356 226587345 0.000000e+00 1190
20 TraesCS4D01G278900 chrUn 91.656 803 64 3 1372 2172 400772680 400773481 0.000000e+00 1109
21 TraesCS4D01G278900 chr1D 91.439 806 68 1 1372 2176 433197973 433197168 0.000000e+00 1105
22 TraesCS4D01G278900 chr1A 85.287 870 106 15 491 1357 218980588 218981438 0.000000e+00 878
23 TraesCS4D01G278900 chr1A 91.949 472 34 4 20 489 218979298 218979767 0.000000e+00 658
24 TraesCS4D01G278900 chr2D 88.785 214 23 1 1158 1371 72151146 72150934 6.490000e-66 261
25 TraesCS4D01G278900 chr4B 81.517 211 14 10 614 806 211582892 211583095 1.470000e-32 150
26 TraesCS4D01G278900 chr5D 89.873 79 8 0 2231 2309 28634005 28634083 4.170000e-18 102


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G278900 chr4D 450210895 450213263 2368 False 4375 4375 100.000 1 2369 1 chr4D.!!$F1 2368
1 TraesCS4D01G278900 chr3A 33835456 33836825 1369 False 2281 2281 96.723 1 1371 1 chr3A.!!$F1 1370
2 TraesCS4D01G278900 chr3A 120245530 120246530 1000 False 1700 1700 97.305 1368 2369 1 chr3A.!!$F3 1001
3 TraesCS4D01G278900 chr3A 33842849 33843849 1000 False 1683 1683 97.006 1368 2369 1 chr3A.!!$F2 1001
4 TraesCS4D01G278900 chr3A 21083406 21084407 1001 True 1552 1552 94.611 1368 2369 1 chr3A.!!$R1 1001
5 TraesCS4D01G278900 chr3A 120238191 120239518 1327 False 1095 1742 95.637 1 1371 2 chr3A.!!$F4 1370
6 TraesCS4D01G278900 chr3A 40153094 40153733 639 True 1074 1074 96.885 1 642 1 chr3A.!!$R2 641
7 TraesCS4D01G278900 chr6A 85543440 85544805 1365 False 2239 2239 96.213 1 1371 1 chr6A.!!$F1 1370
8 TraesCS4D01G278900 chr6A 85550829 85551830 1001 False 1652 1652 96.407 1368 2369 1 chr6A.!!$F2 1001
9 TraesCS4D01G278900 chr3D 592964801 592966154 1353 False 2228 2228 96.215 1 1371 1 chr3D.!!$F1 1370
10 TraesCS4D01G278900 chr4A 374574321 374575673 1352 False 2167 2167 95.408 1 1371 1 chr4A.!!$F1 1370
11 TraesCS4D01G278900 chr1B 127294547 127295917 1370 True 1895 1895 91.744 1 1371 1 chr1B.!!$R1 1370
12 TraesCS4D01G278900 chr2B 190034163 190035163 1000 True 1711 1711 97.505 1368 2369 1 chr2B.!!$R1 1001
13 TraesCS4D01G278900 chr2B 190041198 190042601 1403 True 1114 1247 96.310 1 1371 2 chr2B.!!$R2 1370
14 TraesCS4D01G278900 chr6B 657199977 657200975 998 False 1530 1530 94.294 1368 2366 1 chr6B.!!$F1 998
15 TraesCS4D01G278900 chr6D 226587345 226588356 1011 True 1190 1190 88.212 1368 2363 1 chr6D.!!$R1 995
16 TraesCS4D01G278900 chrUn 400772680 400773481 801 False 1109 1109 91.656 1372 2172 1 chrUn.!!$F1 800
17 TraesCS4D01G278900 chr1D 433197168 433197973 805 True 1105 1105 91.439 1372 2176 1 chr1D.!!$R1 804
18 TraesCS4D01G278900 chr1A 218979298 218981438 2140 False 768 878 88.618 20 1357 2 chr1A.!!$F1 1337

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
134 144 2.841881 TCCTGTAAGAACATACCACCCC 59.158 50.0 0.0 0.0 34.07 4.95 F
458 474 5.457140 TCATTATGTTGTGAAAAACTCGGC 58.543 37.5 0.0 0.0 0.00 5.54 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1222 2134 2.259818 CGTGCTTCGAGCTGGACT 59.740 61.111 0.00 0.0 42.97 3.85 R
1673 2588 4.590647 CCTAAGCAGAATCCTAGGTGATGA 59.409 45.833 9.08 0.0 0.00 2.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
131 141 4.876107 CACCATCCTGTAAGAACATACCAC 59.124 45.833 0.00 0.0 34.07 4.16
134 144 2.841881 TCCTGTAAGAACATACCACCCC 59.158 50.000 0.00 0.0 34.07 4.95
458 474 5.457140 TCATTATGTTGTGAAAAACTCGGC 58.543 37.500 0.00 0.0 0.00 5.54
1222 2134 2.959372 CCACACGACCTCACGCTA 59.041 61.111 0.00 0.0 36.70 4.26
1401 2314 1.259142 TTGACGGCTGGGGTATTCGA 61.259 55.000 0.00 0.0 0.00 3.71
1623 2538 1.620822 GGATCACTGGTTTGCTGGTT 58.379 50.000 0.00 0.0 0.00 3.67
1673 2588 4.719026 ATGAGGTTGCCATCTACATCAT 57.281 40.909 0.00 0.0 41.81 2.45
1685 2600 5.718607 CCATCTACATCATCATCACCTAGGA 59.281 44.000 17.98 0.0 0.00 2.94
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
131 141 4.261741 CGATTTGGAATGCTTTATGAGGGG 60.262 45.833 0.00 0.0 0.00 4.79
134 144 5.200454 CGACGATTTGGAATGCTTTATGAG 58.800 41.667 0.00 0.0 0.00 2.90
307 319 8.538701 TCATATTGCCTTTTGTATTCAACCAAT 58.461 29.630 0.00 0.0 32.93 3.16
701 1554 2.363018 GGGCTTCTTGGGGCCTTC 60.363 66.667 0.84 0.0 46.80 3.46
1222 2134 2.259818 CGTGCTTCGAGCTGGACT 59.740 61.111 0.00 0.0 42.97 3.85
1673 2588 4.590647 CCTAAGCAGAATCCTAGGTGATGA 59.409 45.833 9.08 0.0 0.00 2.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.