Multiple sequence alignment - TraesCS4D01G270900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G270900 chr4D 100.000 2697 0 0 1 2697 441652039 441654735 0.000000e+00 4981.0
1 TraesCS4D01G270900 chr4D 96.852 953 24 2 1001 1953 441809857 441810803 0.000000e+00 1589.0
2 TraesCS4D01G270900 chr4D 82.030 857 107 23 917 1755 441836810 441837637 0.000000e+00 686.0
3 TraesCS4D01G270900 chr4D 83.862 756 80 22 1959 2688 441654932 441654193 0.000000e+00 682.0
4 TraesCS4D01G270900 chr4D 81.043 211 23 7 160 356 441513470 441513677 4.650000e-33 152.0
5 TraesCS4D01G270900 chr4D 79.021 143 14 4 160 287 441638042 441638183 1.720000e-12 84.2
6 TraesCS4D01G270900 chr4A 94.748 1809 59 15 71 1856 25787062 25785267 0.000000e+00 2782.0
7 TraesCS4D01G270900 chr4A 84.942 777 58 19 1967 2697 730145209 730145972 0.000000e+00 732.0
8 TraesCS4D01G270900 chr4A 87.065 603 60 5 1001 1597 25700671 25700081 0.000000e+00 665.0
9 TraesCS4D01G270900 chr4A 81.501 746 98 22 1007 1746 676781707 676782418 6.470000e-161 577.0
10 TraesCS4D01G270900 chr4A 96.610 118 3 1 1844 1960 25770059 25769942 7.620000e-46 195.0
11 TraesCS4D01G270900 chr4A 80.882 204 22 7 163 352 26013780 26013580 7.780000e-31 145.0
12 TraesCS4D01G270900 chr4A 97.590 83 2 0 4 86 25788410 25788328 2.800000e-30 143.0
13 TraesCS4D01G270900 chr4A 93.878 49 3 0 163 211 25804220 25804172 1.040000e-09 75.0
14 TraesCS4D01G270900 chr4B 93.644 1715 74 17 92 1795 548119742 548121432 0.000000e+00 2531.0
15 TraesCS4D01G270900 chr4B 78.638 1072 135 52 781 1814 548184933 548185948 2.280000e-175 625.0
16 TraesCS4D01G270900 chr2D 87.287 763 52 19 1967 2690 190399028 190398272 0.000000e+00 830.0
17 TraesCS4D01G270900 chr2D 80.104 769 108 31 1958 2697 476850219 476850971 5.110000e-147 531.0
18 TraesCS4D01G270900 chr2D 78.667 600 87 28 2123 2697 476850991 476850408 7.100000e-96 361.0
19 TraesCS4D01G270900 chr2D 76.077 209 33 4 158 351 564922364 564922570 2.860000e-15 93.5
20 TraesCS4D01G270900 chr3D 86.382 749 54 26 1967 2681 76404710 76405444 0.000000e+00 774.0
21 TraesCS4D01G270900 chr3D 80.645 775 101 37 1961 2697 432515437 432514674 3.030000e-154 555.0
22 TraesCS4D01G270900 chr2A 85.033 755 80 18 1958 2691 57860290 57861032 0.000000e+00 737.0
23 TraesCS4D01G270900 chr2A 75.588 340 73 7 1064 1398 752977217 752976883 2.780000e-35 159.0
24 TraesCS4D01G270900 chr2A 77.619 210 30 4 158 352 705526658 705526865 7.890000e-21 111.0
25 TraesCS4D01G270900 chrUn 84.513 749 65 18 1971 2690 75281726 75281000 0.000000e+00 693.0
26 TraesCS4D01G270900 chr1D 84.626 735 52 19 1965 2681 480612335 480611644 0.000000e+00 675.0
27 TraesCS4D01G270900 chr1D 79.921 757 72 41 1965 2697 480611444 480612144 1.450000e-132 483.0
28 TraesCS4D01G270900 chr1D 86.207 87 12 0 1511 1597 387216546 387216632 7.950000e-16 95.3
29 TraesCS4D01G270900 chr7A 83.465 762 73 26 1959 2690 650785026 650785764 0.000000e+00 660.0
30 TraesCS4D01G270900 chr7A 83.411 645 76 19 2076 2697 729318243 729317607 1.080000e-158 569.0
31 TraesCS4D01G270900 chr7A 80.285 771 83 41 1962 2697 650785957 650785221 3.980000e-143 518.0
32 TraesCS4D01G270900 chr7A 83.566 572 67 21 2149 2697 645313796 645313229 6.660000e-141 510.0
33 TraesCS4D01G270900 chr7D 83.537 656 84 11 1001 1646 58925517 58924876 2.310000e-165 592.0
34 TraesCS4D01G270900 chr6A 82.481 645 84 19 2076 2697 2590639 2591277 3.060000e-149 538.0
35 TraesCS4D01G270900 chr3B 85.224 379 35 14 2326 2696 50043095 50042730 1.180000e-98 370.0
36 TraesCS4D01G270900 chr3B 81.757 444 50 14 1968 2392 50043528 50043097 2.570000e-90 342.0
37 TraesCS4D01G270900 chr2B 77.619 210 30 4 158 352 676193448 676193655 7.890000e-21 111.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G270900 chr4D 441652039 441654735 2696 False 4981.0 4981 100.0000 1 2697 1 chr4D.!!$F3 2696
1 TraesCS4D01G270900 chr4D 441809857 441810803 946 False 1589.0 1589 96.8520 1001 1953 1 chr4D.!!$F4 952
2 TraesCS4D01G270900 chr4D 441836810 441837637 827 False 686.0 686 82.0300 917 1755 1 chr4D.!!$F5 838
3 TraesCS4D01G270900 chr4D 441654193 441654932 739 True 682.0 682 83.8620 1959 2688 1 chr4D.!!$R1 729
4 TraesCS4D01G270900 chr4A 25785267 25788410 3143 True 1462.5 2782 96.1690 4 1856 2 chr4A.!!$R5 1852
5 TraesCS4D01G270900 chr4A 730145209 730145972 763 False 732.0 732 84.9420 1967 2697 1 chr4A.!!$F2 730
6 TraesCS4D01G270900 chr4A 25700081 25700671 590 True 665.0 665 87.0650 1001 1597 1 chr4A.!!$R1 596
7 TraesCS4D01G270900 chr4A 676781707 676782418 711 False 577.0 577 81.5010 1007 1746 1 chr4A.!!$F1 739
8 TraesCS4D01G270900 chr4B 548119742 548121432 1690 False 2531.0 2531 93.6440 92 1795 1 chr4B.!!$F1 1703
9 TraesCS4D01G270900 chr4B 548184933 548185948 1015 False 625.0 625 78.6380 781 1814 1 chr4B.!!$F2 1033
10 TraesCS4D01G270900 chr2D 190398272 190399028 756 True 830.0 830 87.2870 1967 2690 1 chr2D.!!$R1 723
11 TraesCS4D01G270900 chr2D 476850219 476850971 752 False 531.0 531 80.1040 1958 2697 1 chr2D.!!$F1 739
12 TraesCS4D01G270900 chr2D 476850408 476850991 583 True 361.0 361 78.6670 2123 2697 1 chr2D.!!$R2 574
13 TraesCS4D01G270900 chr3D 76404710 76405444 734 False 774.0 774 86.3820 1967 2681 1 chr3D.!!$F1 714
14 TraesCS4D01G270900 chr3D 432514674 432515437 763 True 555.0 555 80.6450 1961 2697 1 chr3D.!!$R1 736
15 TraesCS4D01G270900 chr2A 57860290 57861032 742 False 737.0 737 85.0330 1958 2691 1 chr2A.!!$F1 733
16 TraesCS4D01G270900 chrUn 75281000 75281726 726 True 693.0 693 84.5130 1971 2690 1 chrUn.!!$R1 719
17 TraesCS4D01G270900 chr1D 480611644 480612335 691 True 675.0 675 84.6260 1965 2681 1 chr1D.!!$R1 716
18 TraesCS4D01G270900 chr1D 480611444 480612144 700 False 483.0 483 79.9210 1965 2697 1 chr1D.!!$F2 732
19 TraesCS4D01G270900 chr7A 650785026 650785764 738 False 660.0 660 83.4650 1959 2690 1 chr7A.!!$F1 731
20 TraesCS4D01G270900 chr7A 729317607 729318243 636 True 569.0 569 83.4110 2076 2697 1 chr7A.!!$R3 621
21 TraesCS4D01G270900 chr7A 650785221 650785957 736 True 518.0 518 80.2850 1962 2697 1 chr7A.!!$R2 735
22 TraesCS4D01G270900 chr7A 645313229 645313796 567 True 510.0 510 83.5660 2149 2697 1 chr7A.!!$R1 548
23 TraesCS4D01G270900 chr7D 58924876 58925517 641 True 592.0 592 83.5370 1001 1646 1 chr7D.!!$R1 645
24 TraesCS4D01G270900 chr6A 2590639 2591277 638 False 538.0 538 82.4810 2076 2697 1 chr6A.!!$F1 621
25 TraesCS4D01G270900 chr3B 50042730 50043528 798 True 356.0 370 83.4905 1968 2696 2 chr3B.!!$R1 728

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
752 2046 0.948623 CAGACCGCGTCCATGTGAAA 60.949 55.0 4.92 0.0 32.18 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1907 3254 2.352814 GGCACTTGAGTTCTCGCTTCTA 60.353 50.0 0.0 0.0 0.0 2.1 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
77 78 3.770424 GACCGGTTACACGCACGC 61.770 66.667 9.42 0.00 0.00 5.34
78 79 4.289245 ACCGGTTACACGCACGCT 62.289 61.111 0.00 0.00 0.00 5.07
249 1532 6.617371 AGATCATATTAGGAACCTGTTGACCT 59.383 38.462 3.36 0.00 36.65 3.85
449 1743 1.885163 AAACCCGGTCCTAGTCAGCG 61.885 60.000 0.00 4.05 34.52 5.18
484 1778 1.804151 GAAATACTCGTGCTGTTGCCA 59.196 47.619 0.00 0.00 38.71 4.92
752 2046 0.948623 CAGACCGCGTCCATGTGAAA 60.949 55.000 4.92 0.00 32.18 2.69
939 2247 1.943340 GCTTAGGCGCTTGCTTCTATT 59.057 47.619 7.64 0.00 39.13 1.73
962 2275 3.446570 GGCATGGCAGCAGACACC 61.447 66.667 15.47 0.00 33.89 4.16
1035 2350 0.731417 CTCCTCTGCTTTGCATTCCG 59.269 55.000 0.00 0.00 38.13 4.30
1044 2359 0.539438 TTTGCATTCCGCCTTCCAGT 60.539 50.000 0.00 0.00 41.33 4.00
1045 2360 0.539438 TTGCATTCCGCCTTCCAGTT 60.539 50.000 0.00 0.00 41.33 3.16
1046 2361 0.960364 TGCATTCCGCCTTCCAGTTC 60.960 55.000 0.00 0.00 41.33 3.01
1047 2362 1.657751 GCATTCCGCCTTCCAGTTCC 61.658 60.000 0.00 0.00 32.94 3.62
1048 2363 0.322456 CATTCCGCCTTCCAGTTCCA 60.322 55.000 0.00 0.00 0.00 3.53
1049 2364 0.404040 ATTCCGCCTTCCAGTTCCAA 59.596 50.000 0.00 0.00 0.00 3.53
1250 2571 1.891150 GTCTTCAAGTACTCGACCCCA 59.109 52.381 0.00 0.00 0.00 4.96
1907 3254 6.600427 CGACCCAAAATAATAGGTACACCTTT 59.400 38.462 6.17 4.03 46.09 3.11
1922 3269 3.321111 ACACCTTTAGAAGCGAGAACTCA 59.679 43.478 2.78 0.00 0.00 3.41
2019 3366 2.420022 CGGTCCGCTCATTTTTGATTCT 59.580 45.455 0.00 0.00 0.00 2.40
2089 3452 1.069090 TTTCGCTGCCGAGTCAACT 59.931 52.632 0.00 0.00 45.35 3.16
2474 3956 2.276201 TCGGATGTCATTTTAGCACGG 58.724 47.619 0.00 0.00 0.00 4.94
2515 3998 1.489481 ACCTGAGCATCTTCGATGGA 58.511 50.000 6.04 0.00 34.92 3.41
2639 4177 0.463620 AAAATTGGCACGCACCTTGT 59.536 45.000 0.00 0.00 0.00 3.16
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
0 1 2.438434 GATGGGCCTTGACCGTGG 60.438 66.667 4.53 0.00 29.56 4.94
1 2 2.438434 GGATGGGCCTTGACCGTG 60.438 66.667 4.53 0.00 29.56 4.94
77 78 1.609208 ACAAGCAACTTGGGCTACAG 58.391 50.000 11.69 0.00 44.81 2.74
78 79 1.953686 GAACAAGCAACTTGGGCTACA 59.046 47.619 11.69 0.00 44.81 2.74
249 1532 4.736168 GCACATTGCACTTTGTACTTCCAA 60.736 41.667 0.00 0.00 44.26 3.53
363 1646 7.443879 TGAATGTTGTTCTTAACTGCTGTATCA 59.556 33.333 0.00 0.00 0.00 2.15
364 1647 7.806690 TGAATGTTGTTCTTAACTGCTGTATC 58.193 34.615 0.00 0.00 0.00 2.24
365 1648 7.744087 TGAATGTTGTTCTTAACTGCTGTAT 57.256 32.000 0.00 0.00 0.00 2.29
368 1651 7.754069 TTTTGAATGTTGTTCTTAACTGCTG 57.246 32.000 0.00 0.00 0.00 4.41
396 1690 6.611381 TGCTTCTTTCTTAATTCCGAACATG 58.389 36.000 0.00 0.00 0.00 3.21
449 1743 6.166911 GAGTATTTCTCGAAGGGTTTGTTC 57.833 41.667 0.00 0.00 33.25 3.18
484 1778 0.107993 CTCAGCATGGACATGACCGT 60.108 55.000 15.99 6.41 41.20 4.83
752 2046 3.003113 GCCTCGCTACCGTTCCACT 62.003 63.158 0.00 0.00 35.54 4.00
921 2229 5.065988 CCTTTAAATAGAAGCAAGCGCCTAA 59.934 40.000 2.29 0.00 39.83 2.69
939 2247 0.039472 TCTGCTGCCATGCCCTTTAA 59.961 50.000 0.00 0.00 0.00 1.52
962 2275 2.855514 CGGGGTTTGGGTTGCTGTG 61.856 63.158 0.00 0.00 0.00 3.66
1035 2350 1.923356 TGGAATTGGAACTGGAAGGC 58.077 50.000 0.00 0.00 39.30 4.35
1044 2359 2.242926 TGATTGCGGTTGGAATTGGAA 58.757 42.857 0.00 0.00 36.14 3.53
1045 2360 1.916506 TGATTGCGGTTGGAATTGGA 58.083 45.000 0.00 0.00 36.14 3.53
1046 2361 2.739885 TTGATTGCGGTTGGAATTGG 57.260 45.000 0.00 0.00 36.14 3.16
1047 2362 2.931325 CCATTGATTGCGGTTGGAATTG 59.069 45.455 0.00 0.00 36.14 2.32
1048 2363 2.677613 GCCATTGATTGCGGTTGGAATT 60.678 45.455 0.00 0.00 36.14 2.17
1049 2364 1.134729 GCCATTGATTGCGGTTGGAAT 60.135 47.619 0.00 0.00 39.04 3.01
1815 3162 6.868622 AGTTAGAAGACTATTGGTACTGCTG 58.131 40.000 0.00 0.00 0.00 4.41
1863 3210 5.221048 GGGTCGATGGTTGGATAAAATTGAG 60.221 44.000 0.00 0.00 0.00 3.02
1907 3254 2.352814 GGCACTTGAGTTCTCGCTTCTA 60.353 50.000 0.00 0.00 0.00 2.10
2019 3366 4.675976 TCTGTCCGGTTTTAGAGTTGAA 57.324 40.909 0.00 0.00 0.00 2.69
2474 3956 2.886587 GCAAGGTGCATGCAAATTTC 57.113 45.000 24.58 10.84 44.26 2.17
2639 4177 4.339247 TGACATCGAAGATACTCAGATGCA 59.661 41.667 0.00 0.00 45.12 3.96


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.