Multiple sequence alignment - TraesCS4D01G267700

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G267700 chr4D 100.000 2598 0 0 1 2598 438680505 438683102 0.000000e+00 4798.0
1 TraesCS4D01G267700 chr4D 97.262 621 16 1 1978 2598 75861348 75861967 0.000000e+00 1051.0
2 TraesCS4D01G267700 chr4D 97.101 621 17 1 1978 2598 379549597 379548978 0.000000e+00 1046.0
3 TraesCS4D01G267700 chr4D 92.334 587 32 5 1 576 267610156 267610740 0.000000e+00 822.0
4 TraesCS4D01G267700 chr4D 91.667 60 5 0 576 635 154387870 154387929 1.660000e-12 84.2
5 TraesCS4D01G267700 chr4A 94.883 1407 71 1 576 1981 28185732 28187138 0.000000e+00 2198.0
6 TraesCS4D01G267700 chr4A 78.869 601 86 25 1 572 62404883 62404295 4.080000e-98 368.0
7 TraesCS4D01G267700 chr4B 92.051 1409 107 3 576 1981 542582271 542583677 0.000000e+00 1977.0
8 TraesCS4D01G267700 chr7D 97.746 621 13 1 1978 2598 546090886 546090267 0.000000e+00 1068.0
9 TraesCS4D01G267700 chr7D 97.262 621 16 1 1978 2598 382907721 382908340 0.000000e+00 1051.0
10 TraesCS4D01G267700 chr7D 87.240 721 87 4 1263 1980 612164032 612163314 0.000000e+00 817.0
11 TraesCS4D01G267700 chr7D 91.130 575 46 5 1 572 216372971 216373543 0.000000e+00 774.0
12 TraesCS4D01G267700 chr7D 85.952 541 69 7 727 1266 612376479 612377013 2.900000e-159 571.0
13 TraesCS4D01G267700 chr7D 83.158 95 14 2 860 953 610990048 610989955 4.610000e-13 86.1
14 TraesCS4D01G267700 chr2D 87.039 949 117 5 741 1686 616755765 616754820 0.000000e+00 1066.0
15 TraesCS4D01G267700 chr2D 97.424 621 15 1 1978 2598 615454875 615454256 0.000000e+00 1057.0
16 TraesCS4D01G267700 chr2D 92.308 572 42 2 3 572 545349569 545350140 0.000000e+00 811.0
17 TraesCS4D01G267700 chr2D 95.000 60 3 0 576 635 516056844 516056785 7.650000e-16 95.3
18 TraesCS4D01G267700 chr2B 86.646 966 121 7 725 1686 752298860 752299821 0.000000e+00 1062.0
19 TraesCS4D01G267700 chr2B 95.000 60 3 0 576 635 800537484 800537543 7.650000e-16 95.3
20 TraesCS4D01G267700 chr1D 97.585 621 14 1 1978 2598 213287105 213286486 0.000000e+00 1062.0
21 TraesCS4D01G267700 chr1D 97.101 621 18 0 1978 2598 63116390 63115770 0.000000e+00 1048.0
22 TraesCS4D01G267700 chr1D 97.101 621 17 1 1978 2598 212898075 212898694 0.000000e+00 1046.0
23 TraesCS4D01G267700 chr1D 97.106 622 15 3 1978 2598 297403656 297403037 0.000000e+00 1046.0
24 TraesCS4D01G267700 chr6D 93.997 583 30 2 1 578 186413322 186413904 0.000000e+00 878.0
25 TraesCS4D01G267700 chr5D 92.683 574 33 7 2 572 254252406 254252973 0.000000e+00 819.0
26 TraesCS4D01G267700 chr5D 93.333 60 4 0 576 635 268969777 268969718 3.560000e-14 89.8
27 TraesCS4D01G267700 chr6B 92.055 579 43 3 1 576 344671514 344670936 0.000000e+00 811.0
28 TraesCS4D01G267700 chr6A 92.101 557 39 5 21 575 185940288 185939735 0.000000e+00 780.0
29 TraesCS4D01G267700 chr2A 91.161 577 43 6 1 575 472724106 472723536 0.000000e+00 776.0
30 TraesCS4D01G267700 chr7A 91.243 571 42 7 6 575 419939276 419938713 0.000000e+00 771.0
31 TraesCS4D01G267700 chr7A 91.803 61 5 0 575 635 619493597 619493537 4.610000e-13 86.1
32 TraesCS4D01G267700 chrUn 93.333 60 4 0 576 635 110866376 110866435 3.560000e-14 89.8
33 TraesCS4D01G267700 chr3B 93.333 60 4 0 576 635 450510013 450510072 3.560000e-14 89.8


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G267700 chr4D 438680505 438683102 2597 False 4798 4798 100.000 1 2598 1 chr4D.!!$F4 2597
1 TraesCS4D01G267700 chr4D 75861348 75861967 619 False 1051 1051 97.262 1978 2598 1 chr4D.!!$F1 620
2 TraesCS4D01G267700 chr4D 379548978 379549597 619 True 1046 1046 97.101 1978 2598 1 chr4D.!!$R1 620
3 TraesCS4D01G267700 chr4D 267610156 267610740 584 False 822 822 92.334 1 576 1 chr4D.!!$F3 575
4 TraesCS4D01G267700 chr4A 28185732 28187138 1406 False 2198 2198 94.883 576 1981 1 chr4A.!!$F1 1405
5 TraesCS4D01G267700 chr4A 62404295 62404883 588 True 368 368 78.869 1 572 1 chr4A.!!$R1 571
6 TraesCS4D01G267700 chr4B 542582271 542583677 1406 False 1977 1977 92.051 576 1981 1 chr4B.!!$F1 1405
7 TraesCS4D01G267700 chr7D 546090267 546090886 619 True 1068 1068 97.746 1978 2598 1 chr7D.!!$R1 620
8 TraesCS4D01G267700 chr7D 382907721 382908340 619 False 1051 1051 97.262 1978 2598 1 chr7D.!!$F2 620
9 TraesCS4D01G267700 chr7D 612163314 612164032 718 True 817 817 87.240 1263 1980 1 chr7D.!!$R3 717
10 TraesCS4D01G267700 chr7D 216372971 216373543 572 False 774 774 91.130 1 572 1 chr7D.!!$F1 571
11 TraesCS4D01G267700 chr7D 612376479 612377013 534 False 571 571 85.952 727 1266 1 chr7D.!!$F3 539
12 TraesCS4D01G267700 chr2D 616754820 616755765 945 True 1066 1066 87.039 741 1686 1 chr2D.!!$R3 945
13 TraesCS4D01G267700 chr2D 615454256 615454875 619 True 1057 1057 97.424 1978 2598 1 chr2D.!!$R2 620
14 TraesCS4D01G267700 chr2D 545349569 545350140 571 False 811 811 92.308 3 572 1 chr2D.!!$F1 569
15 TraesCS4D01G267700 chr2B 752298860 752299821 961 False 1062 1062 86.646 725 1686 1 chr2B.!!$F1 961
16 TraesCS4D01G267700 chr1D 213286486 213287105 619 True 1062 1062 97.585 1978 2598 1 chr1D.!!$R2 620
17 TraesCS4D01G267700 chr1D 63115770 63116390 620 True 1048 1048 97.101 1978 2598 1 chr1D.!!$R1 620
18 TraesCS4D01G267700 chr1D 212898075 212898694 619 False 1046 1046 97.101 1978 2598 1 chr1D.!!$F1 620
19 TraesCS4D01G267700 chr1D 297403037 297403656 619 True 1046 1046 97.106 1978 2598 1 chr1D.!!$R3 620
20 TraesCS4D01G267700 chr6D 186413322 186413904 582 False 878 878 93.997 1 578 1 chr6D.!!$F1 577
21 TraesCS4D01G267700 chr5D 254252406 254252973 567 False 819 819 92.683 2 572 1 chr5D.!!$F1 570
22 TraesCS4D01G267700 chr6B 344670936 344671514 578 True 811 811 92.055 1 576 1 chr6B.!!$R1 575
23 TraesCS4D01G267700 chr6A 185939735 185940288 553 True 780 780 92.101 21 575 1 chr6A.!!$R1 554
24 TraesCS4D01G267700 chr2A 472723536 472724106 570 True 776 776 91.161 1 575 1 chr2A.!!$R1 574
25 TraesCS4D01G267700 chr7A 419938713 419939276 563 True 771 771 91.243 6 575 1 chr7A.!!$R1 569

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
530 572 1.228124 CAACAGTCCGGCCAAAGGA 60.228 57.895 2.24 0.0 34.99 3.36 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1998 2049 3.009473 TCACCCTTTCCTCTTCAATGGAG 59.991 47.826 0.0 0.0 33.46 3.86 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
38 39 2.045242 GGAGGAAAACCTCGCCCC 60.045 66.667 9.67 0.00 37.68 5.80
76 77 2.315925 TGATCGAAGGAGCCATCAAC 57.684 50.000 0.00 0.00 0.00 3.18
252 256 5.078256 CGATGGAGGTAATACCCTACTTCT 58.922 45.833 5.71 0.00 39.75 2.85
529 571 2.268076 CCAACAGTCCGGCCAAAGG 61.268 63.158 2.24 0.00 0.00 3.11
530 572 1.228124 CAACAGTCCGGCCAAAGGA 60.228 57.895 2.24 0.00 34.99 3.36
596 640 5.881443 CCAAACGTCACTTTATATTACCCCA 59.119 40.000 0.00 0.00 0.00 4.96
616 660 7.305246 ACCCCATATGATAGCAACCTTTATTT 58.695 34.615 3.65 0.00 0.00 1.40
824 868 1.935873 CCCTCATTGTCGTGTAGCATG 59.064 52.381 0.00 0.00 0.00 4.06
1014 1059 6.398918 CCACTTCCATCTATATAAAGGGTCG 58.601 44.000 0.00 0.00 0.00 4.79
1215 1260 0.615850 GTTGCAAGAGGAGGTAGCCT 59.384 55.000 0.00 0.00 42.17 4.58
1296 1341 0.326264 GAAGGCCAAGGAAGAGAGCA 59.674 55.000 5.01 0.00 0.00 4.26
1299 1344 0.905357 GGCCAAGGAAGAGAGCACTA 59.095 55.000 0.00 0.00 0.00 2.74
1319 1364 5.127194 CACTAGAACTGTTGCCAGGTATCTA 59.873 44.000 0.00 0.00 39.26 1.98
1329 1374 7.062322 TGTTGCCAGGTATCTATTCATGAATT 58.938 34.615 25.26 10.94 32.50 2.17
1376 1421 3.055747 GCAAGGAGTACTACCAAGAGCTT 60.056 47.826 0.00 0.00 0.00 3.74
1377 1422 4.563786 GCAAGGAGTACTACCAAGAGCTTT 60.564 45.833 0.00 0.00 0.00 3.51
1496 1541 5.878669 ACAAACGAAGGAAGAAAAGTAGTGT 59.121 36.000 0.00 0.00 0.00 3.55
1612 1659 8.659925 TGTTGCAATGAATAAACTTGTTTGAT 57.340 26.923 0.59 0.00 0.00 2.57
1783 1831 3.338818 AACATCGCCATTTAATGAGCG 57.661 42.857 24.16 24.16 45.10 5.03
1794 1842 5.572896 CCATTTAATGAGCGAACAAACTTCC 59.427 40.000 6.50 0.00 0.00 3.46
1942 1993 8.946797 TTCATCATGGATATCTTGAGAGACTA 57.053 34.615 2.05 0.00 33.99 2.59
1998 2049 0.040958 CTTGAGCACTGCGTTGGTTC 60.041 55.000 0.00 0.00 0.00 3.62
2002 2053 1.891919 GCACTGCGTTGGTTCTCCA 60.892 57.895 0.00 0.00 42.66 3.86
2406 2457 6.765036 ACTGTCGAGCAATTGATAGAATTGAT 59.235 34.615 10.34 4.66 39.36 2.57
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
38 39 0.930310 ATCAACAACGATGCGATCCG 59.070 50.000 0.00 0.00 0.00 4.18
76 77 0.108804 ACTGTGCCGTCACGATAAGG 60.109 55.000 0.00 0.00 46.01 2.69
164 168 1.069765 CCATCCGCCTTAGACGCAT 59.930 57.895 0.00 0.00 0.00 4.73
252 256 8.685838 TCATATCATCAAGATCAATCAAGCAA 57.314 30.769 0.00 0.00 38.19 3.91
281 286 5.585445 TCTCGTGGTAGATCAACTCTTCTAC 59.415 44.000 0.00 2.26 42.27 2.59
284 289 4.966965 TCTCGTGGTAGATCAACTCTTC 57.033 45.455 0.00 0.00 35.28 2.87
421 462 3.141398 AGCTTGGCAATACGGATATGTG 58.859 45.455 0.00 0.00 0.00 3.21
498 540 5.163447 CCGGACTGTTGGACTATGAAGATAA 60.163 44.000 0.00 0.00 0.00 1.75
572 616 5.881443 TGGGGTAATATAAAGTGACGTTTGG 59.119 40.000 0.00 0.00 0.00 3.28
616 660 1.584175 TTAAAAGCGACGGACTGCAA 58.416 45.000 0.00 0.00 0.00 4.08
824 868 8.854979 AAGCATTTCAATTTTTGGCTAAAAAC 57.145 26.923 21.12 7.66 45.53 2.43
1014 1059 1.186200 GGTTTGAAAGAGGGGATGGC 58.814 55.000 0.00 0.00 0.00 4.40
1215 1260 5.513094 CCACCACAATCTCTCTTTCTAACCA 60.513 44.000 0.00 0.00 0.00 3.67
1329 1374 6.325028 CACTCCTCATGGTTAAGATCCTCTAA 59.675 42.308 0.00 0.00 34.23 2.10
1376 1421 4.305769 CAATTTCTTGGTTGATCCGCAAA 58.694 39.130 0.00 0.00 38.44 3.68
1377 1422 3.860378 GCAATTTCTTGGTTGATCCGCAA 60.860 43.478 0.00 0.00 39.52 4.85
1496 1541 8.190326 CACATATGGACTAGGTATGGAAGTTA 57.810 38.462 7.80 0.00 31.68 2.24
1750 1798 6.949578 ATGGCGATGTTTTTCTTTTGTATG 57.050 33.333 0.00 0.00 0.00 2.39
1828 1876 5.721000 AGATCCCTTTGTGCCAAATTTCATA 59.279 36.000 1.56 0.00 0.00 2.15
1940 1991 4.338682 GGGGTCATGTACTAGTGTGAGTAG 59.661 50.000 5.39 0.00 32.56 2.57
1942 1993 3.097614 GGGGTCATGTACTAGTGTGAGT 58.902 50.000 5.39 0.00 0.00 3.41
1998 2049 3.009473 TCACCCTTTCCTCTTCAATGGAG 59.991 47.826 0.00 0.00 33.46 3.86
2002 2053 3.245371 TGCATCACCCTTTCCTCTTCAAT 60.245 43.478 0.00 0.00 0.00 2.57
2257 2308 5.731591 ACTAGCTATTTCTGTAGCCGTTTT 58.268 37.500 0.00 0.00 46.48 2.43
2265 2316 4.951715 TCCCGTCAACTAGCTATTTCTGTA 59.048 41.667 0.00 0.00 0.00 2.74
2428 2479 9.217336 ACCTGATGCCTATATACATGATCATAA 57.783 33.333 8.15 0.00 0.00 1.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.