Multiple sequence alignment - TraesCS4D01G262200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G262200 chr4D 100.000 2493 0 0 1 2493 433308250 433305758 0 4604
1 TraesCS4D01G262200 chr3D 98.798 2495 27 3 1 2493 68827256 68824763 0 4438
2 TraesCS4D01G262200 chr5D 98.718 2496 27 4 1 2493 55023991 55021498 0 4427
3 TraesCS4D01G262200 chr5D 98.638 2497 28 5 1 2493 335823514 335826008 0 4418
4 TraesCS4D01G262200 chr1D 98.677 2495 31 2 1 2493 203582855 203585349 0 4423
5 TraesCS4D01G262200 chr1D 98.557 2494 32 3 1 2493 19993787 19991297 0 4403
6 TraesCS4D01G262200 chr7D 98.678 2496 27 6 1 2493 567322005 567324497 0 4421
7 TraesCS4D01G262200 chr7D 98.557 2494 32 4 1 2493 200270888 200273378 0 4403
8 TraesCS4D01G262200 chr7D 98.479 2498 32 6 1 2493 589613504 589611008 0 4397
9 TraesCS4D01G262200 chr7D 98.317 2495 30 6 1 2493 253131761 253129277 0 4364


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G262200 chr4D 433305758 433308250 2492 True 4604 4604 100.000 1 2493 1 chr4D.!!$R1 2492
1 TraesCS4D01G262200 chr3D 68824763 68827256 2493 True 4438 4438 98.798 1 2493 1 chr3D.!!$R1 2492
2 TraesCS4D01G262200 chr5D 55021498 55023991 2493 True 4427 4427 98.718 1 2493 1 chr5D.!!$R1 2492
3 TraesCS4D01G262200 chr5D 335823514 335826008 2494 False 4418 4418 98.638 1 2493 1 chr5D.!!$F1 2492
4 TraesCS4D01G262200 chr1D 203582855 203585349 2494 False 4423 4423 98.677 1 2493 1 chr1D.!!$F1 2492
5 TraesCS4D01G262200 chr1D 19991297 19993787 2490 True 4403 4403 98.557 1 2493 1 chr1D.!!$R1 2492
6 TraesCS4D01G262200 chr7D 567322005 567324497 2492 False 4421 4421 98.678 1 2493 1 chr7D.!!$F2 2492
7 TraesCS4D01G262200 chr7D 200270888 200273378 2490 False 4403 4403 98.557 1 2493 1 chr7D.!!$F1 2492
8 TraesCS4D01G262200 chr7D 589611008 589613504 2496 True 4397 4397 98.479 1 2493 1 chr7D.!!$R2 2492
9 TraesCS4D01G262200 chr7D 253129277 253131761 2484 True 4364 4364 98.317 1 2493 1 chr7D.!!$R1 2492

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
624 633 2.219458 CATCCTGATTGGCTACTGCAG 58.781 52.381 13.48 13.48 41.91 4.41 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2358 2372 2.745281 GTTTAGACACGGCTAATTGGCA 59.255 45.455 16.2 0.0 41.89 4.92 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
624 633 2.219458 CATCCTGATTGGCTACTGCAG 58.781 52.381 13.48 13.48 41.91 4.41
923 933 3.298686 TCCTCTCGAGCAATTCCTCTA 57.701 47.619 7.81 0.00 0.00 2.43
935 945 6.967897 AGCAATTCCTCTATTTCTTCCTCTT 58.032 36.000 0.00 0.00 0.00 2.85
1309 1319 0.394762 TCAATCTGCCCCATGACAGC 60.395 55.000 0.00 0.00 33.80 4.40
1406 1416 5.128919 AGATGAACAAGAACTTCAAGCAGT 58.871 37.500 0.00 0.00 31.48 4.40
1514 1524 8.827677 GTTAGAGATGTTTGTCTACTGTTGTTT 58.172 33.333 0.00 0.00 28.10 2.83
1520 1530 6.408035 TGTTTGTCTACTGTTGTTTCCACTA 58.592 36.000 0.00 0.00 0.00 2.74
1648 1658 4.127171 GCAGAAGACAAGTACCAGTTCAA 58.873 43.478 0.00 0.00 0.00 2.69
1774 1784 3.953612 AGTTCATCTCTTCTCTCTCGCAT 59.046 43.478 0.00 0.00 0.00 4.73
2358 2372 7.865530 AGTTAGTTTGGTTAATTTTCCCCAT 57.134 32.000 0.00 0.00 0.00 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
624 633 2.477754 CGTAAAAACCCGAGAAGGACAC 59.522 50.000 0.00 0.0 45.00 3.67
923 933 4.141390 ACATATCGCCCAAGAGGAAGAAAT 60.141 41.667 0.00 0.0 38.24 2.17
1124 1134 3.706594 AGGATGCGAGGAAAACTCAGATA 59.293 43.478 0.00 0.0 46.98 1.98
1406 1416 5.535783 TGGATTGCTTCTTCAACTCAATCAA 59.464 36.000 13.15 1.9 42.67 2.57
1487 1497 7.497595 ACAACAGTAGACAAACATCTCTAACA 58.502 34.615 0.00 0.0 0.00 2.41
1514 1524 6.115446 CAGACTTGGATTGCTAAATAGTGGA 58.885 40.000 0.00 0.0 0.00 4.02
1520 1530 8.814038 AGATAAACAGACTTGGATTGCTAAAT 57.186 30.769 0.00 0.0 0.00 1.40
1833 1843 4.497674 GCCTATTGCAGCTTGATTCTCTTG 60.498 45.833 0.00 0.0 40.77 3.02
2358 2372 2.745281 GTTTAGACACGGCTAATTGGCA 59.255 45.455 16.20 0.0 41.89 4.92


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.