Multiple sequence alignment - TraesCS4D01G261100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G261100 chr4D 100.000 2828 0 0 1 2828 431675028 431672201 0.000000e+00 5223
1 TraesCS4D01G261100 chr4D 96.743 2855 57 11 1 2827 431621666 431618820 0.000000e+00 4724
2 TraesCS4D01G261100 chr4D 96.656 2841 79 9 1 2828 431555901 431553064 0.000000e+00 4706
3 TraesCS4D01G261100 chr4D 96.615 2127 55 7 715 2828 431722517 431720395 0.000000e+00 3513
4 TraesCS4D01G261100 chr4D 96.940 719 22 0 1 719 431734567 431733849 0.000000e+00 1206
5 TraesCS4D01G261100 chr4D 93.258 623 40 2 1 621 32770779 32771401 0.000000e+00 917
6 TraesCS4D01G261100 chr4D 79.463 1042 175 21 777 1792 11165358 11164330 0.000000e+00 702
7 TraesCS4D01G261100 chrUn 91.652 1162 92 4 627 1786 256114484 256115642 0.000000e+00 1604
8 TraesCS4D01G261100 chrUn 91.652 1162 92 4 627 1786 390478305 390479463 0.000000e+00 1604
9 TraesCS4D01G261100 chr5B 91.652 1162 92 4 627 1786 660880522 660879364 0.000000e+00 1604
10 TraesCS4D01G261100 chr5B 91.149 1175 99 4 627 1799 660926471 660925300 0.000000e+00 1589
11 TraesCS4D01G261100 chr4A 91.702 952 69 7 901 1851 32714959 32714017 0.000000e+00 1312
12 TraesCS4D01G261100 chr4A 89.565 345 21 8 2293 2625 32707486 32707145 9.370000e-115 424
13 TraesCS4D01G261100 chr4A 92.446 278 17 4 627 903 32715263 32714989 7.340000e-106 394
14 TraesCS4D01G261100 chr4A 89.950 199 19 1 2549 2747 32707186 32706989 3.620000e-64 255
15 TraesCS4D01G261100 chr4A 90.446 157 15 0 629 785 591293066 591293222 1.030000e-49 207
16 TraesCS4D01G261100 chr6D 93.087 622 39 4 1 619 351928991 351928371 0.000000e+00 907
17 TraesCS4D01G261100 chr6D 92.926 622 41 3 1 619 137121726 137122347 0.000000e+00 902
18 TraesCS4D01G261100 chr5D 93.322 614 36 5 1 611 408653840 408654451 0.000000e+00 902
19 TraesCS4D01G261100 chr3D 93.148 613 39 3 1 611 578275087 578274476 0.000000e+00 896
20 TraesCS4D01G261100 chr7D 92.110 621 47 2 8 626 538991054 538991674 0.000000e+00 874
21 TraesCS4D01G261100 chr4B 85.714 742 94 9 932 1666 21153424 21152688 0.000000e+00 773
22 TraesCS4D01G261100 chr7B 93.266 297 16 3 1939 2231 529283791 529283495 4.330000e-118 435
23 TraesCS4D01G261100 chr7B 93.023 301 16 4 1939 2235 655112485 655112186 4.330000e-118 435
24 TraesCS4D01G261100 chr7B 93.243 296 16 3 1940 2231 527368321 527368616 1.560000e-117 433
25 TraesCS4D01G261100 chr2B 92.763 304 17 4 1940 2238 480355599 480355296 4.330000e-118 435
26 TraesCS4D01G261100 chr2B 93.000 300 16 4 1936 2231 555725239 555725537 1.560000e-117 433
27 TraesCS4D01G261100 chr3B 91.613 310 22 3 1940 2245 787100325 787100634 2.600000e-115 425


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G261100 chr4D 431672201 431675028 2827 True 5223 5223 100.000 1 2828 1 chr4D.!!$R4 2827
1 TraesCS4D01G261100 chr4D 431618820 431621666 2846 True 4724 4724 96.743 1 2827 1 chr4D.!!$R3 2826
2 TraesCS4D01G261100 chr4D 431553064 431555901 2837 True 4706 4706 96.656 1 2828 1 chr4D.!!$R2 2827
3 TraesCS4D01G261100 chr4D 431720395 431722517 2122 True 3513 3513 96.615 715 2828 1 chr4D.!!$R5 2113
4 TraesCS4D01G261100 chr4D 431733849 431734567 718 True 1206 1206 96.940 1 719 1 chr4D.!!$R6 718
5 TraesCS4D01G261100 chr4D 32770779 32771401 622 False 917 917 93.258 1 621 1 chr4D.!!$F1 620
6 TraesCS4D01G261100 chr4D 11164330 11165358 1028 True 702 702 79.463 777 1792 1 chr4D.!!$R1 1015
7 TraesCS4D01G261100 chrUn 256114484 256115642 1158 False 1604 1604 91.652 627 1786 1 chrUn.!!$F1 1159
8 TraesCS4D01G261100 chrUn 390478305 390479463 1158 False 1604 1604 91.652 627 1786 1 chrUn.!!$F2 1159
9 TraesCS4D01G261100 chr5B 660879364 660880522 1158 True 1604 1604 91.652 627 1786 1 chr5B.!!$R1 1159
10 TraesCS4D01G261100 chr5B 660925300 660926471 1171 True 1589 1589 91.149 627 1799 1 chr5B.!!$R2 1172
11 TraesCS4D01G261100 chr4A 32714017 32715263 1246 True 853 1312 92.074 627 1851 2 chr4A.!!$R2 1224
12 TraesCS4D01G261100 chr6D 351928371 351928991 620 True 907 907 93.087 1 619 1 chr6D.!!$R1 618
13 TraesCS4D01G261100 chr6D 137121726 137122347 621 False 902 902 92.926 1 619 1 chr6D.!!$F1 618
14 TraesCS4D01G261100 chr5D 408653840 408654451 611 False 902 902 93.322 1 611 1 chr5D.!!$F1 610
15 TraesCS4D01G261100 chr3D 578274476 578275087 611 True 896 896 93.148 1 611 1 chr3D.!!$R1 610
16 TraesCS4D01G261100 chr7D 538991054 538991674 620 False 874 874 92.110 8 626 1 chr7D.!!$F1 618
17 TraesCS4D01G261100 chr4B 21152688 21153424 736 True 773 773 85.714 932 1666 1 chr4B.!!$R1 734

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
417 422 0.249073 CTAACGTAGCTGCGCAGGAT 60.249 55.000 36.47 19.59 34.88 3.24 F
478 483 4.466370 TGAGATGAGTAGTACTTGTTGGGG 59.534 45.833 0.00 0.00 0.00 4.96 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1567 1616 0.457851 CTGAAGGCGGAGTCGAAGAT 59.542 55.000 0.00 0.0 40.67 2.40 R
1867 1932 1.202114 GATGCCGGATGAAAAACTGCA 59.798 47.619 5.05 0.0 0.00 4.41 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
191 193 4.394729 ACAACTAGGTAAACACACATGGG 58.605 43.478 0.00 0.00 0.00 4.00
283 286 6.983890 GGCAACTACCATAAATTAAACATGGG 59.016 38.462 14.43 2.46 42.98 4.00
304 307 8.798402 CATGGGAACTATAGTTAACCAAAACAA 58.202 33.333 30.24 15.90 43.57 2.83
326 329 5.582689 AATAGAGTTGCCATGCTTTTACC 57.417 39.130 0.00 0.00 0.00 2.85
417 422 0.249073 CTAACGTAGCTGCGCAGGAT 60.249 55.000 36.47 19.59 34.88 3.24
478 483 4.466370 TGAGATGAGTAGTACTTGTTGGGG 59.534 45.833 0.00 0.00 0.00 4.96
712 717 5.241506 TCATGTTTGGTCTTTCATCCTTCAC 59.758 40.000 0.00 0.00 0.00 3.18
1671 1720 3.449018 AGTCTGCCGTCAAGAAGATGTAT 59.551 43.478 0.00 0.00 0.00 2.29
1867 1932 7.849322 ACAAATATTAGGAGGTGTTTGGTTT 57.151 32.000 0.00 0.00 32.73 3.27
2536 2605 3.443588 GCGGTGGCCTGTTTTCTT 58.556 55.556 3.32 0.00 0.00 2.52
2555 2636 0.902984 TCCAGCCGTGCTTTCCTCTA 60.903 55.000 0.00 0.00 36.40 2.43
2795 2876 3.498018 CACGGACATGACAGAATGAAACA 59.502 43.478 0.00 0.00 39.69 2.83
2817 2898 1.067915 TCGTTGACTCGTGCATCATCA 60.068 47.619 0.00 0.00 0.00 3.07
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
94 95 3.068560 GTTTATCTGGTTGCCACGTACA 58.931 45.455 0.00 0.0 0.00 2.90
191 193 4.387862 CCACATACGGTCAAACAGTAGTTC 59.612 45.833 0.00 0.0 36.84 3.01
304 307 5.016173 TGGTAAAAGCATGGCAACTCTATT 58.984 37.500 0.00 0.0 37.61 1.73
326 329 2.239400 TCCGGGATAGCAGATGTAGTG 58.761 52.381 0.00 0.0 0.00 2.74
417 422 1.537776 CGAAGCAAAAATGCCCACACA 60.538 47.619 0.00 0.0 34.90 3.72
455 460 4.466370 CCCCAACAAGTACTACTCATCTCA 59.534 45.833 0.00 0.0 0.00 3.27
478 483 0.447801 CAGCTATTTCGTGCCACACC 59.552 55.000 0.00 0.0 0.00 4.16
712 717 4.844349 ATCCTCCAAATATATCCACCCG 57.156 45.455 0.00 0.0 0.00 5.28
866 872 1.150536 CTCCTCCTCTCCTCTCCCG 59.849 68.421 0.00 0.0 0.00 5.14
1194 1243 4.659172 TTGGGCTTGTCCGCTGGG 62.659 66.667 0.00 0.0 34.94 4.45
1290 1339 3.136077 AGACGACCCTAGTGCTGATACTA 59.864 47.826 0.00 0.0 32.19 1.82
1567 1616 0.457851 CTGAAGGCGGAGTCGAAGAT 59.542 55.000 0.00 0.0 40.67 2.40
1671 1720 3.296854 ACTCTCAGGAACATATACGGCA 58.703 45.455 0.00 0.0 0.00 5.69
1867 1932 1.202114 GATGCCGGATGAAAAACTGCA 59.798 47.619 5.05 0.0 0.00 4.41
2251 2319 2.607635 CGGTATCATGCTAAAACTGCGT 59.392 45.455 0.00 0.0 0.00 5.24
2309 2377 1.452801 GGGGGTTGACTCGGTTTGA 59.547 57.895 0.00 0.0 0.00 2.69
2529 2598 0.668535 AAGCACGGCTGGAAGAAAAC 59.331 50.000 0.00 0.0 39.62 2.43
2530 2599 1.336755 GAAAGCACGGCTGGAAGAAAA 59.663 47.619 0.00 0.0 39.62 2.29
2531 2600 0.951558 GAAAGCACGGCTGGAAGAAA 59.048 50.000 0.00 0.0 39.62 2.52
2536 2605 0.902984 TAGAGGAAAGCACGGCTGGA 60.903 55.000 0.00 0.0 39.62 3.86
2727 2808 2.365293 GGGAGGTGTTTGTTTGCAGATT 59.635 45.455 0.00 0.0 0.00 2.40
2795 2876 0.313987 TGATGCACGAGTCAACGAGT 59.686 50.000 0.00 0.0 37.03 4.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.