Multiple sequence alignment - TraesCS4D01G261000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G261000 chr4D 100.000 2837 0 0 1 2837 431621671 431618835 0.000000e+00 5240
1 TraesCS4D01G261000 chr4D 96.766 2845 56 11 1 2837 431675033 431672217 0.000000e+00 4711
2 TraesCS4D01G261000 chr4D 96.169 2845 83 7 1 2837 431555906 431553080 0.000000e+00 4626
3 TraesCS4D01G261000 chr4D 95.814 2126 62 5 720 2837 431722517 431720411 0.000000e+00 3408
4 TraesCS4D01G261000 chr4D 97.649 723 17 0 2 724 431734571 431733849 0.000000e+00 1242
5 TraesCS4D01G261000 chr4D 93.301 627 40 2 2 626 32770775 32771401 0.000000e+00 924
6 TraesCS4D01G261000 chr4D 78.531 1048 185 21 782 1797 11165358 11164319 0.000000e+00 652
7 TraesCS4D01G261000 chr4D 92.881 295 16 3 1956 2245 314234542 314234836 9.400000e-115 424
8 TraesCS4D01G261000 chrUn 90.558 1165 100 5 632 1789 256114484 256115645 0.000000e+00 1533
9 TraesCS4D01G261000 chrUn 90.558 1165 100 5 632 1789 390478305 390479466 0.000000e+00 1533
10 TraesCS4D01G261000 chr5B 90.558 1165 100 5 632 1789 660880522 660879361 0.000000e+00 1533
11 TraesCS4D01G261000 chr5B 90.530 1151 102 2 632 1775 660926471 660925321 0.000000e+00 1515
12 TraesCS4D01G261000 chr4A 89.990 959 74 9 906 1858 32714959 32714017 0.000000e+00 1219
13 TraesCS4D01G261000 chr4A 92.464 345 22 4 2307 2650 32707486 32707145 9.130000e-135 490
14 TraesCS4D01G261000 chr4A 92.086 278 18 4 632 908 32715263 32714989 3.430000e-104 388
15 TraesCS4D01G261000 chr4A 89.394 198 20 1 2576 2772 32707186 32706989 6.070000e-62 248
16 TraesCS4D01G261000 chr6D 93.301 627 39 3 1 624 137121721 137122347 0.000000e+00 922
17 TraesCS4D01G261000 chr6D 93.301 627 38 4 1 624 351928996 351928371 0.000000e+00 922
18 TraesCS4D01G261000 chr7D 92.587 634 44 3 1 631 422574685 422575318 0.000000e+00 907
19 TraesCS4D01G261000 chr5D 93.355 617 36 5 3 616 408653837 408654451 0.000000e+00 907
20 TraesCS4D01G261000 chr1D 92.675 628 41 4 1 624 18806076 18806702 0.000000e+00 900
21 TraesCS4D01G261000 chr4B 84.853 746 101 9 937 1675 21153419 21152679 0.000000e+00 741
22 TraesCS4D01G261000 chr3D 83.112 527 80 6 2253 2773 555110416 555109893 3.310000e-129 472
23 TraesCS4D01G261000 chr7B 92.359 301 16 5 1955 2249 655112485 655112186 3.380000e-114 422
24 TraesCS4D01G261000 chr2B 92.105 304 17 5 1956 2252 480355599 480355296 3.380000e-114 422
25 TraesCS4D01G261000 chr2B 93.950 281 12 4 1952 2228 555725239 555725518 1.220000e-113 420
26 TraesCS4D01G261000 chr3B 92.079 303 17 4 1950 2245 651374089 651373787 1.220000e-113 420
27 TraesCS4D01G261000 chr3B 90.968 310 22 4 1956 2259 787100325 787100634 2.030000e-111 412
28 TraesCS4D01G261000 chr3B 83.200 250 35 4 2529 2772 738138090 738137842 3.680000e-54 222


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G261000 chr4D 431618835 431621671 2836 True 5240.0 5240 100.000 1 2837 1 chr4D.!!$R3 2836
1 TraesCS4D01G261000 chr4D 431672217 431675033 2816 True 4711.0 4711 96.766 1 2837 1 chr4D.!!$R4 2836
2 TraesCS4D01G261000 chr4D 431553080 431555906 2826 True 4626.0 4626 96.169 1 2837 1 chr4D.!!$R2 2836
3 TraesCS4D01G261000 chr4D 431720411 431722517 2106 True 3408.0 3408 95.814 720 2837 1 chr4D.!!$R5 2117
4 TraesCS4D01G261000 chr4D 431733849 431734571 722 True 1242.0 1242 97.649 2 724 1 chr4D.!!$R6 722
5 TraesCS4D01G261000 chr4D 32770775 32771401 626 False 924.0 924 93.301 2 626 1 chr4D.!!$F1 624
6 TraesCS4D01G261000 chr4D 11164319 11165358 1039 True 652.0 652 78.531 782 1797 1 chr4D.!!$R1 1015
7 TraesCS4D01G261000 chrUn 256114484 256115645 1161 False 1533.0 1533 90.558 632 1789 1 chrUn.!!$F1 1157
8 TraesCS4D01G261000 chrUn 390478305 390479466 1161 False 1533.0 1533 90.558 632 1789 1 chrUn.!!$F2 1157
9 TraesCS4D01G261000 chr5B 660879361 660880522 1161 True 1533.0 1533 90.558 632 1789 1 chr5B.!!$R1 1157
10 TraesCS4D01G261000 chr5B 660925321 660926471 1150 True 1515.0 1515 90.530 632 1775 1 chr5B.!!$R2 1143
11 TraesCS4D01G261000 chr4A 32714017 32715263 1246 True 803.5 1219 91.038 632 1858 2 chr4A.!!$R2 1226
12 TraesCS4D01G261000 chr6D 137121721 137122347 626 False 922.0 922 93.301 1 624 1 chr6D.!!$F1 623
13 TraesCS4D01G261000 chr6D 351928371 351928996 625 True 922.0 922 93.301 1 624 1 chr6D.!!$R1 623
14 TraesCS4D01G261000 chr7D 422574685 422575318 633 False 907.0 907 92.587 1 631 1 chr7D.!!$F1 630
15 TraesCS4D01G261000 chr5D 408653837 408654451 614 False 907.0 907 93.355 3 616 1 chr5D.!!$F1 613
16 TraesCS4D01G261000 chr1D 18806076 18806702 626 False 900.0 900 92.675 1 624 1 chr1D.!!$F1 623
17 TraesCS4D01G261000 chr4B 21152679 21153419 740 True 741.0 741 84.853 937 1675 1 chr4B.!!$R1 738
18 TraesCS4D01G261000 chr3D 555109893 555110416 523 True 472.0 472 83.112 2253 2773 1 chr3D.!!$R1 520

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
803 811 2.711883 TACCCCACGAGGTCAACCGA 62.712 60.0 0.0 0.0 41.58 4.69 F
1318 1370 0.179161 CACTAGGGTCGTCTTCGCTG 60.179 60.0 0.0 0.0 36.96 5.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1647 1699 0.603569 TCTTCTTGACGGCAGACTCC 59.396 55.0 0.00 0.00 0.00 3.85 R
2588 2648 0.816421 AAAACAGGAACCCGTCGGTG 60.816 55.0 11.06 3.79 43.71 4.94 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
680 688 5.104360 CCCCTAAGAGAGGTTCATCATTCAA 60.104 44.000 0.00 0.0 45.03 2.69
803 811 2.711883 TACCCCACGAGGTCAACCGA 62.712 60.000 0.00 0.0 41.58 4.69
1318 1370 0.179161 CACTAGGGTCGTCTTCGCTG 60.179 60.000 0.00 0.0 36.96 5.18
1612 1664 1.215173 CCATTAAGGAGACCATGGGCA 59.785 52.381 22.78 0.0 41.22 5.36
1639 1691 5.710984 CATACAAGGACTACAAGTTCGTCT 58.289 41.667 0.00 0.0 0.00 4.18
1647 1699 0.670546 ACAAGTTCGTCTCCGCCATG 60.671 55.000 0.00 0.0 0.00 3.66
2496 2555 1.341156 CCCGAGCTTCCCCTCTTCAT 61.341 60.000 0.00 0.0 0.00 2.57
2576 2636 2.200337 GGAACCCAGCCGTGCTTTT 61.200 57.895 0.00 0.0 36.40 2.27
2588 2648 0.179179 GTGCTTTTCTCTGCGCCATC 60.179 55.000 4.18 0.0 34.05 3.51
2589 2649 0.606130 TGCTTTTCTCTGCGCCATCA 60.606 50.000 4.18 0.0 0.00 3.07
2706 2769 3.367646 TTTCGGTTTATGCCCATACCA 57.632 42.857 0.00 0.0 0.00 3.25
2724 2787 7.041644 CCCATACCATTTACATTAACGGTGTAG 60.042 40.741 0.00 0.0 33.92 2.74
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
680 688 1.999648 AACATGATGTTGTGGCCACT 58.000 45.000 34.75 16.57 39.45 4.00
863 871 3.111484 CCTCTCCTCTCCCTTTTTAGCT 58.889 50.000 0.00 0.00 0.00 3.32
1062 1114 0.666274 CTTTGGCAGCGTACGAGACA 60.666 55.000 21.65 16.18 0.00 3.41
1178 1230 4.329545 GAGGGACCACGGCTGCAA 62.330 66.667 0.50 0.00 0.00 4.08
1330 1382 4.740822 GCCCTGGGCGTTCATGGT 62.741 66.667 24.16 0.00 39.62 3.55
1361 1413 2.353803 GCCACGAAGGAGTCATACTTGT 60.354 50.000 2.86 0.00 41.22 3.16
1612 1664 5.351465 CGAACTTGTAGTCCTTGTATGCATT 59.649 40.000 3.54 0.00 0.00 3.56
1639 1691 3.785859 GGCAGACTCCATGGCGGA 61.786 66.667 6.96 0.00 43.61 5.54
1647 1699 0.603569 TCTTCTTGACGGCAGACTCC 59.396 55.000 0.00 0.00 0.00 3.85
1856 1909 9.185680 GAACCAAACACCTCCTAATATTTGTAT 57.814 33.333 0.00 0.00 0.00 2.29
2262 2318 1.807139 TCATGCTAAAACTGCGCTGA 58.193 45.000 21.92 2.66 0.00 4.26
2576 2636 3.068064 TCGGTGATGGCGCAGAGA 61.068 61.111 10.83 0.00 0.00 3.10
2588 2648 0.816421 AAAACAGGAACCCGTCGGTG 60.816 55.000 11.06 3.79 43.71 4.94
2706 2769 8.974060 AATGGATCTACACCGTTAATGTAAAT 57.026 30.769 0.00 0.00 35.24 1.40
2755 2818 1.561643 TGGGAGGTGTTTGTTTGCAA 58.438 45.000 0.00 0.00 0.00 4.08


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.