Multiple sequence alignment - TraesCS4D01G256500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G256500 chr4D 100.000 4037 0 0 1 4037 426259253 426263289 0.000000e+00 7456
1 TraesCS4D01G256500 chr1D 96.707 4069 92 10 1 4037 285946095 285942037 0.000000e+00 6734
2 TraesCS4D01G256500 chr1D 96.661 3803 91 9 1 3769 88001792 88005592 0.000000e+00 6287
3 TraesCS4D01G256500 chr1D 94.641 3620 156 13 183 3769 371727120 371723506 0.000000e+00 5576
4 TraesCS4D01G256500 chr1D 96.497 3226 68 11 1 3197 95401412 95404621 0.000000e+00 5289
5 TraesCS4D01G256500 chr1D 97.062 1770 40 7 2272 4037 78746169 78747930 0.000000e+00 2970
6 TraesCS4D01G256500 chr3D 96.789 3799 87 8 1 3769 254412479 254416272 0.000000e+00 6307
7 TraesCS4D01G256500 chr3D 96.053 3800 112 13 1 3769 421487182 421483390 0.000000e+00 6152
8 TraesCS4D01G256500 chr3D 94.274 751 22 12 3301 4037 353288712 353287969 0.000000e+00 1129
9 TraesCS4D01G256500 chr5D 96.130 3798 110 11 1 3769 108658754 108662543 0.000000e+00 6165
10 TraesCS4D01G256500 chr7D 95.925 3804 121 11 1 3773 588637667 588641467 0.000000e+00 6135
11 TraesCS4D01G256500 chr7D 94.472 3817 147 19 1 3773 291619359 291615563 0.000000e+00 5821
12 TraesCS4D01G256500 chr7D 97.150 3228 60 7 1 3197 387299878 387296652 0.000000e+00 5422
13 TraesCS4D01G256500 chr7D 95.174 1347 36 7 1 1320 243727393 243728737 0.000000e+00 2100
14 TraesCS4D01G256500 chr7D 96.617 739 16 4 3301 4037 387296652 387295921 0.000000e+00 1218
15 TraesCS4D01G256500 chr2D 94.622 3812 151 13 1 3769 258399631 258395831 0.000000e+00 5854
16 TraesCS4D01G256500 chr6D 96.253 3229 87 9 1 3197 249271187 249267961 0.000000e+00 5262
17 TraesCS4D01G256500 chr6D 96.622 740 15 5 3301 4037 249267961 249267229 0.000000e+00 1219
18 TraesCS4D01G256500 chr2A 95.816 741 19 5 3301 4037 433271261 433270529 0.000000e+00 1186
19 TraesCS4D01G256500 chr1A 92.683 738 30 14 3301 4035 435198342 435197626 0.000000e+00 1042
20 TraesCS4D01G256500 chr5A 93.864 440 19 5 3601 4037 664431411 664431845 0.000000e+00 656
21 TraesCS4D01G256500 chr4A 93.575 358 13 5 3682 4037 484100157 484099808 3.570000e-145 525


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G256500 chr4D 426259253 426263289 4036 False 7456.0 7456 100.0000 1 4037 1 chr4D.!!$F1 4036
1 TraesCS4D01G256500 chr1D 285942037 285946095 4058 True 6734.0 6734 96.7070 1 4037 1 chr1D.!!$R1 4036
2 TraesCS4D01G256500 chr1D 88001792 88005592 3800 False 6287.0 6287 96.6610 1 3769 1 chr1D.!!$F2 3768
3 TraesCS4D01G256500 chr1D 371723506 371727120 3614 True 5576.0 5576 94.6410 183 3769 1 chr1D.!!$R2 3586
4 TraesCS4D01G256500 chr1D 95401412 95404621 3209 False 5289.0 5289 96.4970 1 3197 1 chr1D.!!$F3 3196
5 TraesCS4D01G256500 chr1D 78746169 78747930 1761 False 2970.0 2970 97.0620 2272 4037 1 chr1D.!!$F1 1765
6 TraesCS4D01G256500 chr3D 254412479 254416272 3793 False 6307.0 6307 96.7890 1 3769 1 chr3D.!!$F1 3768
7 TraesCS4D01G256500 chr3D 421483390 421487182 3792 True 6152.0 6152 96.0530 1 3769 1 chr3D.!!$R2 3768
8 TraesCS4D01G256500 chr3D 353287969 353288712 743 True 1129.0 1129 94.2740 3301 4037 1 chr3D.!!$R1 736
9 TraesCS4D01G256500 chr5D 108658754 108662543 3789 False 6165.0 6165 96.1300 1 3769 1 chr5D.!!$F1 3768
10 TraesCS4D01G256500 chr7D 588637667 588641467 3800 False 6135.0 6135 95.9250 1 3773 1 chr7D.!!$F2 3772
11 TraesCS4D01G256500 chr7D 291615563 291619359 3796 True 5821.0 5821 94.4720 1 3773 1 chr7D.!!$R1 3772
12 TraesCS4D01G256500 chr7D 387295921 387299878 3957 True 3320.0 5422 96.8835 1 4037 2 chr7D.!!$R2 4036
13 TraesCS4D01G256500 chr7D 243727393 243728737 1344 False 2100.0 2100 95.1740 1 1320 1 chr7D.!!$F1 1319
14 TraesCS4D01G256500 chr2D 258395831 258399631 3800 True 5854.0 5854 94.6220 1 3769 1 chr2D.!!$R1 3768
15 TraesCS4D01G256500 chr6D 249267229 249271187 3958 True 3240.5 5262 96.4375 1 4037 2 chr6D.!!$R1 4036
16 TraesCS4D01G256500 chr2A 433270529 433271261 732 True 1186.0 1186 95.8160 3301 4037 1 chr2A.!!$R1 736
17 TraesCS4D01G256500 chr1A 435197626 435198342 716 True 1042.0 1042 92.6830 3301 4035 1 chr1A.!!$R1 734

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
573 593 0.249573 TTCCGTCGGTTTGAGTGTCC 60.250 55.000 11.88 0.0 0.0 4.02 F
587 607 1.375908 TGTCCTGATTCACTGCGCC 60.376 57.895 4.18 0.0 0.0 6.53 F
1027 1048 2.489971 TGATGTTGACTTCCGTGGTTC 58.510 47.619 0.00 0.0 0.0 3.62 F
2361 2422 3.136992 TCATGATGCCTCTATTCAAGCCA 59.863 43.478 0.00 0.0 0.0 4.75 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1861 1919 2.037901 TGCAAAAACTTCCCAGATGCA 58.962 42.857 0.00 0.0 39.73 3.96 R
1941 1999 5.043248 GCAAAATCAACATTTCTATCGGGG 58.957 41.667 0.00 0.0 30.37 5.73 R
2943 3010 5.759506 ACACAACTCTATACAGATCCTCG 57.240 43.478 0.00 0.0 0.00 4.63 R
3786 4078 2.106684 CAGCCTAGAAAATAGGTCCCCC 59.893 54.545 3.05 0.0 37.06 5.40 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
260 262 3.003275 TGTCGCAAGGAAATTGAACTGAC 59.997 43.478 0.00 0.00 41.83 3.51
562 582 1.732259 CTGAATTTGAGGTTCCGTCGG 59.268 52.381 4.39 4.39 0.00 4.79
573 593 0.249573 TTCCGTCGGTTTGAGTGTCC 60.250 55.000 11.88 0.00 0.00 4.02
587 607 1.375908 TGTCCTGATTCACTGCGCC 60.376 57.895 4.18 0.00 0.00 6.53
875 896 7.401955 TGTTAACATGCATGATTGTGGATTA 57.598 32.000 32.75 14.76 0.00 1.75
1027 1048 2.489971 TGATGTTGACTTCCGTGGTTC 58.510 47.619 0.00 0.00 0.00 3.62
1139 1161 6.348950 CGTATTTGAACTTTACCCTTGATGCA 60.349 38.462 0.00 0.00 0.00 3.96
1148 1170 6.948309 ACTTTACCCTTGATGCAGTCTTTTAT 59.052 34.615 0.00 0.00 0.00 1.40
1941 1999 8.511604 TCCTTATTGATGATTGGAAGAAAGAC 57.488 34.615 0.00 0.00 0.00 3.01
2004 2062 4.454678 TGCTGAGTCCATATTTCATCACC 58.545 43.478 0.00 0.00 0.00 4.02
2149 2208 3.486841 GTGCTTGACTGTACGTTTTACGA 59.513 43.478 6.19 0.00 46.05 3.43
2361 2422 3.136992 TCATGATGCCTCTATTCAAGCCA 59.863 43.478 0.00 0.00 0.00 4.75
2943 3010 4.498009 CCTCGTATTGTTGATTGGAATGCC 60.498 45.833 0.00 0.00 0.00 4.40
3264 3333 8.805175 ACTTGTGTATGATTCATTTGGAATTCA 58.195 29.630 7.93 0.00 46.17 2.57
3717 4009 9.997482 TTGTTTGAACTTCTTGAATTGTAGTAC 57.003 29.630 0.00 0.00 0.00 2.73
3869 4165 6.456501 ACTTGCCTTACAGACTAAGTTGTAG 58.543 40.000 0.00 0.00 31.95 2.74
4003 4303 5.105106 TGTTCAAGTGTACCAGAACTCTCAA 60.105 40.000 14.26 0.00 40.62 3.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
260 262 8.389603 ACTCAAGTTAAAATTGCAACAAACATG 58.610 29.630 0.00 7.49 0.00 3.21
562 582 3.058639 GCAGTGAATCAGGACACTCAAAC 60.059 47.826 0.00 0.00 44.07 2.93
573 593 1.089112 TTCATGGCGCAGTGAATCAG 58.911 50.000 18.91 0.00 29.93 2.90
587 607 2.422479 CTGCATCACTCCAGGTTTCATG 59.578 50.000 0.00 0.00 0.00 3.07
898 919 0.326264 ATCCTCCCGGCAATGATAGC 59.674 55.000 0.00 0.00 0.00 2.97
1027 1048 1.234615 ACAGGGTTCGATGCCAAACG 61.235 55.000 8.51 0.00 0.00 3.60
1090 1111 7.389330 ACGTAATTCATGACAGTACCAATCAAA 59.611 33.333 0.00 0.00 0.00 2.69
1599 1655 7.413000 CGCTAAGCAACAGATTATACAACTTGT 60.413 37.037 0.00 0.00 0.00 3.16
1861 1919 2.037901 TGCAAAAACTTCCCAGATGCA 58.962 42.857 0.00 0.00 39.73 3.96
1941 1999 5.043248 GCAAAATCAACATTTCTATCGGGG 58.957 41.667 0.00 0.00 30.37 5.73
2004 2062 7.456253 AGAAACAAACGATCTGATTGATTACG 58.544 34.615 11.82 2.51 35.14 3.18
2149 2208 7.272515 CGACATTAAACGGTTTATTTTCAGCAT 59.727 33.333 13.63 0.13 0.00 3.79
2361 2422 8.870116 ACTTTCTTATCCTTTGCTAAAACCATT 58.130 29.630 0.00 0.00 0.00 3.16
2943 3010 5.759506 ACACAACTCTATACAGATCCTCG 57.240 43.478 0.00 0.00 0.00 4.63
3408 3685 6.990939 ACAAGAAAAGAGGGTACAGAAACTAC 59.009 38.462 0.00 0.00 0.00 2.73
3786 4078 2.106684 CAGCCTAGAAAATAGGTCCCCC 59.893 54.545 3.05 0.00 37.06 5.40
3787 4079 2.778270 ACAGCCTAGAAAATAGGTCCCC 59.222 50.000 3.05 0.00 37.06 4.81
3788 4080 3.433740 CCACAGCCTAGAAAATAGGTCCC 60.434 52.174 3.05 0.00 37.06 4.46
3869 4165 9.204570 ACAGTAATAGTACAACTGAAATGTCAC 57.795 33.333 18.63 0.00 42.59 3.67
3972 4272 2.678836 TGGTACACTTGAACAAACGGTG 59.321 45.455 0.00 0.00 0.00 4.94


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.