Multiple sequence alignment - TraesCS4D01G255300

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G255300 chr4D 100.000 3200 0 0 1 3200 424111499 424108300 0.000000e+00 5910.0
1 TraesCS4D01G255300 chr4D 96.162 3205 91 17 3 3200 424170512 424167333 0.000000e+00 5208.0
2 TraesCS4D01G255300 chr4D 95.397 2303 74 10 565 2843 423990217 423987923 0.000000e+00 3637.0
3 TraesCS4D01G255300 chr4D 98.613 1730 21 1 1471 3200 424196575 424194849 0.000000e+00 3059.0
4 TraesCS4D01G255300 chr4D 94.608 1762 92 3 565 2324 424323102 424321342 0.000000e+00 2724.0
5 TraesCS4D01G255300 chr4D 89.835 1633 111 28 804 2399 57840501 57842115 0.000000e+00 2045.0
6 TraesCS4D01G255300 chr4D 86.573 1430 135 35 821 2224 426870123 426871521 0.000000e+00 1524.0
7 TraesCS4D01G255300 chr4D 92.808 876 52 9 2328 3200 424309149 424308282 0.000000e+00 1258.0
8 TraesCS4D01G255300 chr4D 92.734 867 49 10 2339 3200 424194811 424193954 0.000000e+00 1240.0
9 TraesCS4D01G255300 chr4D 93.466 551 35 1 565 1114 424197767 424197217 0.000000e+00 817.0
10 TraesCS4D01G255300 chr4D 91.277 470 22 3 1 451 424447120 424446651 9.750000e-175 623.0
11 TraesCS4D01G255300 chr4D 89.362 470 24 5 1 452 424244278 424243817 4.630000e-158 568.0
12 TraesCS4D01G255300 chr4D 96.454 141 4 1 431 570 424446374 424446234 6.900000e-57 231.0
13 TraesCS4D01G255300 chr4D 92.199 141 9 2 431 570 424243541 424243402 7.000000e-47 198.0
14 TraesCS4D01G255300 chr4D 80.427 281 16 24 2537 2815 427021210 427021453 9.120000e-41 178.0
15 TraesCS4D01G255300 chr4D 84.058 138 14 4 2261 2397 427015841 427015971 3.350000e-25 126.0
16 TraesCS4D01G255300 chr4D 95.833 48 2 0 474 521 424243662 424243615 9.520000e-11 78.7
17 TraesCS4D01G255300 chr4A 93.883 1929 88 14 810 2724 40260686 40262598 0.000000e+00 2881.0
18 TraesCS4D01G255300 chr4A 89.818 275 21 3 2125 2399 539140511 539140778 2.360000e-91 346.0
19 TraesCS4D01G255300 chr4A 94.030 134 7 1 2710 2843 40262613 40262745 5.410000e-48 202.0
20 TraesCS4D01G255300 chr4A 78.261 299 43 13 27 306 40255174 40255469 4.240000e-39 172.0
21 TraesCS4D01G255300 chr4B 92.143 2049 113 17 810 2847 520298421 520296410 0.000000e+00 2848.0
22 TraesCS4D01G255300 chr4B 89.783 1566 103 42 817 2358 86132213 86130681 0.000000e+00 1953.0
23 TraesCS4D01G255300 chr4B 84.168 1478 170 39 804 2251 522669258 522670701 0.000000e+00 1375.0
24 TraesCS4D01G255300 chr4B 90.909 374 28 3 2474 2843 520281360 520280989 6.160000e-137 497.0
25 TraesCS4D01G255300 chr4B 89.761 293 27 1 2852 3144 520296453 520296164 3.900000e-99 372.0
26 TraesCS4D01G255300 chr4B 90.726 248 19 1 2425 2672 86097062 86096819 8.560000e-86 327.0
27 TraesCS4D01G255300 chrUn 93.432 472 27 4 1 470 60141113 60140644 0.000000e+00 697.0
28 TraesCS4D01G255300 chrUn 93.432 472 27 4 1 470 235655460 235654991 0.000000e+00 697.0
29 TraesCS4D01G255300 chrUn 94.498 309 12 2 810 1113 60140575 60140267 3.740000e-129 472.0
30 TraesCS4D01G255300 chr5D 96.970 33 1 0 141 173 38735721 38735753 4.460000e-04 56.5


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G255300 chr4D 424108300 424111499 3199 True 5910.000000 5910 100.000000 1 3200 1 chr4D.!!$R2 3199
1 TraesCS4D01G255300 chr4D 424167333 424170512 3179 True 5208.000000 5208 96.162000 3 3200 1 chr4D.!!$R3 3197
2 TraesCS4D01G255300 chr4D 423987923 423990217 2294 True 3637.000000 3637 95.397000 565 2843 1 chr4D.!!$R1 2278
3 TraesCS4D01G255300 chr4D 424321342 424323102 1760 True 2724.000000 2724 94.608000 565 2324 1 chr4D.!!$R5 1759
4 TraesCS4D01G255300 chr4D 57840501 57842115 1614 False 2045.000000 2045 89.835000 804 2399 1 chr4D.!!$F1 1595
5 TraesCS4D01G255300 chr4D 424193954 424197767 3813 True 1705.333333 3059 94.937667 565 3200 3 chr4D.!!$R6 2635
6 TraesCS4D01G255300 chr4D 426870123 426871521 1398 False 1524.000000 1524 86.573000 821 2224 1 chr4D.!!$F2 1403
7 TraesCS4D01G255300 chr4D 424308282 424309149 867 True 1258.000000 1258 92.808000 2328 3200 1 chr4D.!!$R4 872
8 TraesCS4D01G255300 chr4D 424446234 424447120 886 True 427.000000 623 93.865500 1 570 2 chr4D.!!$R8 569
9 TraesCS4D01G255300 chr4D 424243402 424244278 876 True 281.566667 568 92.464667 1 570 3 chr4D.!!$R7 569
10 TraesCS4D01G255300 chr4A 40260686 40262745 2059 False 1541.500000 2881 93.956500 810 2843 2 chr4A.!!$F3 2033
11 TraesCS4D01G255300 chr4B 86130681 86132213 1532 True 1953.000000 1953 89.783000 817 2358 1 chr4B.!!$R2 1541
12 TraesCS4D01G255300 chr4B 520296164 520298421 2257 True 1610.000000 2848 90.952000 810 3144 2 chr4B.!!$R4 2334
13 TraesCS4D01G255300 chr4B 522669258 522670701 1443 False 1375.000000 1375 84.168000 804 2251 1 chr4B.!!$F1 1447
14 TraesCS4D01G255300 chrUn 60140267 60141113 846 True 584.500000 697 93.965000 1 1113 2 chrUn.!!$R2 1112

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
458 777 1.068921 GTTGCGGCCACCAAAATGT 59.931 52.632 2.24 0.0 0.0 2.71 F
1209 1575 0.726827 GCAAGATCGTCGCCATCAAA 59.273 50.000 0.00 0.0 0.0 2.69 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1653 2413 0.178891 AGTCTTCCTTCCCCAGCAGA 60.179 55.000 0.00 0.0 0.00 4.26 R
3027 4778 2.270205 CAGTGCCTGGGCTCGATT 59.730 61.111 13.05 0.0 42.51 3.34 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
458 777 1.068921 GTTGCGGCCACCAAAATGT 59.931 52.632 2.24 0.0 0.00 2.71
693 1013 5.394553 GGAATCGAAGATTGCAAGGGAAAAT 60.395 40.000 4.94 0.0 45.12 1.82
1209 1575 0.726827 GCAAGATCGTCGCCATCAAA 59.273 50.000 0.00 0.0 0.00 2.69
1653 2413 1.568504 TCTACTTGGCACCCGAGATT 58.431 50.000 5.53 0.0 37.20 2.40
1740 2503 2.811317 CTCACCGGCAAGACGCTC 60.811 66.667 0.00 0.0 41.91 5.03
1981 2750 0.469705 ATTCCAGGTGTTGCAAGGCA 60.470 50.000 0.00 0.0 36.47 4.75
2014 2783 2.254350 CCGACAAGCGACTGACGA 59.746 61.111 3.29 0.0 45.77 4.20
2121 2902 2.978156 AGAAGGCACCAAGGATCAAA 57.022 45.000 0.00 0.0 0.00 2.69
2410 3208 6.665474 ACGTAGTGTTGACATGTTGTTTAA 57.335 33.333 0.00 0.0 42.51 1.52
2744 4495 5.486063 ACATGGTATAGTTTGGTACCTGTCA 59.514 40.000 14.36 0.0 40.78 3.58
2752 4503 4.841246 AGTTTGGTACCTGTCAGATCTTCT 59.159 41.667 14.36 0.0 0.00 2.85
2780 4531 1.819288 CGAGCTGTGGAAGAAGACCTA 59.181 52.381 0.00 0.0 0.00 3.08
3027 4778 1.649321 AGCTGTTCATCCCTGTCTCA 58.351 50.000 0.00 0.0 0.00 3.27
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
119 123 6.756542 ACAAACACTCACCTTTTGATTAAAGC 59.243 34.615 0.52 0.00 41.60 3.51
370 391 8.644216 TGATTGGTACTTTGTCAGTTTACTCTA 58.356 33.333 0.00 0.00 36.88 2.43
375 396 6.714810 AGCATGATTGGTACTTTGTCAGTTTA 59.285 34.615 0.00 0.00 36.88 2.01
419 441 2.311463 CTCAGACCTGTCGATATGGGT 58.689 52.381 0.00 0.00 34.45 4.51
458 777 0.875728 CGCCGGGTTGTTGTTATCAA 59.124 50.000 2.18 0.00 0.00 2.57
693 1013 1.066908 CTTTCTTTCTTGGCGGTTGCA 59.933 47.619 0.00 0.00 45.35 4.08
1209 1575 1.254954 GTCCTCCCAGTTGACGTACT 58.745 55.000 0.00 0.00 0.00 2.73
1653 2413 0.178891 AGTCTTCCTTCCCCAGCAGA 60.179 55.000 0.00 0.00 0.00 4.26
1740 2503 1.000171 TCATCATCATCGCCGAGGAAG 60.000 52.381 5.27 0.65 0.00 3.46
1981 2750 2.971598 CGGGGTTGCAGGTGAGGAT 61.972 63.158 0.00 0.00 0.00 3.24
2121 2902 3.889692 ATGGCCGGCGGGATGAAT 61.890 61.111 29.48 1.99 34.06 2.57
2744 4495 3.023119 AGCTCGATGTGTCAGAAGATCT 58.977 45.455 0.00 0.00 0.00 2.75
2780 4531 4.410099 TGAATTTGCTTCATTCTCCCTGT 58.590 39.130 5.17 0.00 38.97 4.00
3027 4778 2.270205 CAGTGCCTGGGCTCGATT 59.730 61.111 13.05 0.00 42.51 3.34


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.