Multiple sequence alignment - TraesCS4D01G240500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G240500 chr4D 100.000 2619 0 0 1 2619 403009001 403011619 0 4837
1 TraesCS4D01G240500 chr2D 98.207 2621 41 4 1 2619 644817771 644820387 0 4575
2 TraesCS4D01G240500 chr5A 97.978 2621 50 2 1 2619 139476834 139474215 0 4543
3 TraesCS4D01G240500 chr7D 97.976 2619 49 3 1 2619 29571716 29569102 0 4540
4 TraesCS4D01G240500 chr1D 97.404 2619 64 3 1 2619 187808477 187811091 0 4457
5 TraesCS4D01G240500 chr4B 95.705 2631 97 4 1 2619 74348790 74351416 0 4218
6 TraesCS4D01G240500 chr2B 95.059 2287 102 6 343 2619 63131876 63129591 0 3587
7 TraesCS4D01G240500 chr3D 95.878 2038 77 5 584 2619 107214418 107216450 0 3291
8 TraesCS4D01G240500 chr3D 95.939 591 18 5 1 588 107205665 107206252 0 953
9 TraesCS4D01G240500 chr6D 92.640 1807 87 14 1 1781 433250905 433252691 0 2558
10 TraesCS4D01G240500 chr6A 97.872 1363 24 4 1 1360 615073840 615072480 0 2351
11 TraesCS4D01G240500 chr6A 98.278 987 16 1 1633 2619 615072488 615071503 0 1727
12 TraesCS4D01G240500 chr2A 92.764 1617 82 12 182 1781 605004802 605003204 0 2305
13 TraesCS4D01G240500 chr7B 95.943 1257 50 1 1363 2619 400417620 400416365 0 2037
14 TraesCS4D01G240500 chr6B 95.825 527 19 3 1 526 128934555 128934031 0 848


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G240500 chr4D 403009001 403011619 2618 False 4837 4837 100.000 1 2619 1 chr4D.!!$F1 2618
1 TraesCS4D01G240500 chr2D 644817771 644820387 2616 False 4575 4575 98.207 1 2619 1 chr2D.!!$F1 2618
2 TraesCS4D01G240500 chr5A 139474215 139476834 2619 True 4543 4543 97.978 1 2619 1 chr5A.!!$R1 2618
3 TraesCS4D01G240500 chr7D 29569102 29571716 2614 True 4540 4540 97.976 1 2619 1 chr7D.!!$R1 2618
4 TraesCS4D01G240500 chr1D 187808477 187811091 2614 False 4457 4457 97.404 1 2619 1 chr1D.!!$F1 2618
5 TraesCS4D01G240500 chr4B 74348790 74351416 2626 False 4218 4218 95.705 1 2619 1 chr4B.!!$F1 2618
6 TraesCS4D01G240500 chr2B 63129591 63131876 2285 True 3587 3587 95.059 343 2619 1 chr2B.!!$R1 2276
7 TraesCS4D01G240500 chr3D 107214418 107216450 2032 False 3291 3291 95.878 584 2619 1 chr3D.!!$F2 2035
8 TraesCS4D01G240500 chr3D 107205665 107206252 587 False 953 953 95.939 1 588 1 chr3D.!!$F1 587
9 TraesCS4D01G240500 chr6D 433250905 433252691 1786 False 2558 2558 92.640 1 1781 1 chr6D.!!$F1 1780
10 TraesCS4D01G240500 chr6A 615071503 615073840 2337 True 2039 2351 98.075 1 2619 2 chr6A.!!$R1 2618
11 TraesCS4D01G240500 chr2A 605003204 605004802 1598 True 2305 2305 92.764 182 1781 1 chr2A.!!$R1 1599
12 TraesCS4D01G240500 chr7B 400416365 400417620 1255 True 2037 2037 95.943 1363 2619 1 chr7B.!!$R1 1256
13 TraesCS4D01G240500 chr6B 128934031 128934555 524 True 848 848 95.825 1 526 1 chr6B.!!$R1 525

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
850 887 0.531532 GGAGGCACACATCTCATCCG 60.532 60.0 0.0 0.0 0.0 4.18 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2222 2289 0.824759 GGGTTGCTGACGGTAGAGAT 59.175 55.0 0.0 0.0 0.0 2.75 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
355 363 1.129326 CTCGTCCACGCCGATAATTC 58.871 55.000 0.0 0.0 39.60 2.17
611 647 7.698130 GTGGCTTAAAAGTATTGTCATTGCTAG 59.302 37.037 0.0 0.0 0.00 3.42
850 887 0.531532 GGAGGCACACATCTCATCCG 60.532 60.000 0.0 0.0 0.00 4.18
1147 1185 3.565307 ACAATGTGTGTTCAATGGGTCT 58.435 40.909 0.0 0.0 37.01 3.85
1443 1486 8.303156 TGTAATACAAAATGAAACATGGTGGAG 58.697 33.333 0.0 0.0 0.00 3.86
1469 1515 2.375766 CGTGACTGAGCTGGCGAAC 61.376 63.158 0.0 0.0 0.00 3.95
1691 1758 8.866956 CCTCAACTCAGATTCATTTTATTTTGC 58.133 33.333 0.0 0.0 0.00 3.68
2286 2353 5.592054 GGCATAGCCTTTTTCCAATCTTAC 58.408 41.667 0.0 0.0 46.69 2.34
2395 2462 7.436933 CAGTCATCTATAAGGTCAGCATGTTA 58.563 38.462 0.0 0.0 37.40 2.41
2442 2509 6.918892 TGCTATTTCTATGCACACGTAAAT 57.081 33.333 0.0 0.0 0.00 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
195 203 7.717436 TGGAACACACTGAATAAATGTCACTTA 59.283 33.333 0.00 0.0 0.00 2.24
213 221 2.625790 GGCATGTAAAGGTTGGAACACA 59.374 45.455 0.00 0.0 39.29 3.72
529 565 2.491693 CAAACAAACTCGGGCCATATGT 59.508 45.455 4.39 0.0 0.00 2.29
631 667 8.832521 CGGCAATAAGGTACAAATATGTTCTTA 58.167 33.333 0.00 0.0 41.05 2.10
850 887 5.734855 TCTTTGGAGCGTGCTTTTATATC 57.265 39.130 0.00 0.0 0.00 1.63
1147 1185 1.000163 GACTTGTGCGTGAGAAGAGGA 60.000 52.381 1.35 0.0 0.00 3.71
1216 1257 2.158279 TCTCCCACTAACCACCTGTGTA 60.158 50.000 0.00 0.0 0.00 2.90
1267 1308 0.034896 CTTCTACGCACCACCCTTGT 59.965 55.000 0.00 0.0 0.00 3.16
1443 1486 1.446966 GCTCAGTCACGAAGCCCTC 60.447 63.158 0.00 0.0 0.00 4.30
1469 1515 3.371168 CGTTTCCACCACTGACATTTTG 58.629 45.455 0.00 0.0 0.00 2.44
1691 1758 7.430441 TGATCCATCAAAATCATGCATAAGTG 58.570 34.615 0.00 0.0 33.08 3.16
1853 1920 1.269569 GGCGGGTTTTCCTCTGTTTTG 60.270 52.381 0.00 0.0 40.46 2.44
2208 2275 8.044908 TGACGGTAGAGATATGCTATATGTACA 58.955 37.037 0.00 0.0 0.00 2.90
2222 2289 0.824759 GGGTTGCTGACGGTAGAGAT 59.175 55.000 0.00 0.0 0.00 2.75
2228 2295 4.309950 GACGGGGTTGCTGACGGT 62.310 66.667 0.00 0.0 0.00 4.83
2286 2353 3.705604 ACAAAGCAAAGACCAATTGACG 58.294 40.909 7.12 0.0 0.00 4.35
2395 2462 7.687592 GCAATATAAATGAATCAACCAAGCCCT 60.688 37.037 0.00 0.0 0.00 5.19


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.