Multiple sequence alignment - TraesCS4D01G238000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G238000 chr4D 100.000 2421 0 0 1 2421 400125093 400127513 0.000000e+00 4471.0
1 TraesCS4D01G238000 chr4D 100.000 40 0 0 1406 1445 400126539 400126578 9.280000e-10 75.0
2 TraesCS4D01G238000 chr5D 98.844 2422 27 1 1 2421 545193077 545195498 0.000000e+00 4316.0
3 TraesCS4D01G238000 chr6D 98.554 2421 34 1 1 2421 348875 346456 0.000000e+00 4276.0
4 TraesCS4D01G238000 chr6D 100.000 40 0 0 1406 1445 347430 347391 9.280000e-10 75.0
5 TraesCS4D01G238000 chr3A 97.936 2423 45 5 1 2421 40979127 40976708 0.000000e+00 4193.0
6 TraesCS4D01G238000 chr3A 98.088 1621 31 0 1 1621 500029420 500031040 0.000000e+00 2822.0
7 TraesCS4D01G238000 chr3A 96.646 805 26 1 1617 2421 500038670 500039473 0.000000e+00 1336.0
8 TraesCS4D01G238000 chr1A 97.317 2423 51 3 1 2421 45391982 45394392 0.000000e+00 4102.0
9 TraesCS4D01G238000 chr1A 100.000 41 0 0 1447 1487 45393377 45393417 2.580000e-10 76.8
10 TraesCS4D01G238000 chrUn 97.810 2374 50 1 1 2372 43102356 43099983 0.000000e+00 4095.0
11 TraesCS4D01G238000 chrUn 100.000 41 0 0 1447 1487 43100949 43100909 2.580000e-10 76.8
12 TraesCS4D01G238000 chr4A 96.439 1685 60 0 737 2421 507108534 507106850 0.000000e+00 2780.0


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G238000 chr4D 400125093 400127513 2420 False 2273.0 4471 100.0000 1 2421 2 chr4D.!!$F1 2420
1 TraesCS4D01G238000 chr5D 545193077 545195498 2421 False 4316.0 4316 98.8440 1 2421 1 chr5D.!!$F1 2420
2 TraesCS4D01G238000 chr6D 346456 348875 2419 True 2175.5 4276 99.2770 1 2421 2 chr6D.!!$R1 2420
3 TraesCS4D01G238000 chr3A 40976708 40979127 2419 True 4193.0 4193 97.9360 1 2421 1 chr3A.!!$R1 2420
4 TraesCS4D01G238000 chr3A 500029420 500031040 1620 False 2822.0 2822 98.0880 1 1621 1 chr3A.!!$F1 1620
5 TraesCS4D01G238000 chr3A 500038670 500039473 803 False 1336.0 1336 96.6460 1617 2421 1 chr3A.!!$F2 804
6 TraesCS4D01G238000 chr1A 45391982 45394392 2410 False 2089.4 4102 98.6585 1 2421 2 chr1A.!!$F1 2420
7 TraesCS4D01G238000 chrUn 43099983 43102356 2373 True 2085.9 4095 98.9050 1 2372 2 chrUn.!!$R1 2371
8 TraesCS4D01G238000 chr4A 507106850 507108534 1684 True 2780.0 2780 96.4390 737 2421 1 chr4A.!!$R1 1684

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
545 550 1.610522 GCAGAGCAGACAACCAACATT 59.389 47.619 0.0 0.0 0.0 2.71 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2163 2168 1.070758 TGGCAACTCGCTCTTCTTCTT 59.929 47.619 0.0 0.0 41.91 2.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
418 420 1.909700 ACCCAGCCACTACATTTGTG 58.090 50.000 0.0 0.0 35.39 3.33
545 550 1.610522 GCAGAGCAGACAACCAACATT 59.389 47.619 0.0 0.0 0.00 2.71
958 963 5.016173 CCAAAACATTGGGAGGTTCTATCA 58.984 41.667 0.0 0.0 38.42 2.15
1445 1450 6.656314 TTGTATTAGTTACAACATGCCTCG 57.344 37.500 0.0 0.0 44.08 4.63
1651 1656 7.926018 ACCTTTGTATGGTCAAATTTCAAGTTC 59.074 33.333 0.0 0.0 36.83 3.01
2163 2168 1.271054 GGCAGAGAGGCAAAGAGAACA 60.271 52.381 0.0 0.0 43.51 3.18
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
315 316 9.950680 AGATATTTCAAAGTTACAATAATGGCG 57.049 29.630 0.00 0.0 0.00 5.69
418 420 3.181454 ACAATACTGTACCCATGCTAGCC 60.181 47.826 13.29 0.0 32.54 3.93
1623 1628 6.095432 TGAAATTTGACCATACAAAGGTGG 57.905 37.500 0.00 0.0 41.87 4.61
1696 1701 7.162082 AGTTGTAGAATAGTTGGTTCCTTCTG 58.838 38.462 0.00 0.0 0.00 3.02
1697 1702 7.317722 AGTTGTAGAATAGTTGGTTCCTTCT 57.682 36.000 0.00 0.0 0.00 2.85
2132 2137 2.787994 CCTCTCTGCCTGTTGTTCAAT 58.212 47.619 0.00 0.0 0.00 2.57
2163 2168 1.070758 TGGCAACTCGCTCTTCTTCTT 59.929 47.619 0.00 0.0 41.91 2.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.