Multiple sequence alignment - TraesCS4D01G236200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G236200 chr4D 100.000 2579 0 0 1 2579 398051504 398048926 0 4763
1 TraesCS4D01G236200 chr7D 99.303 2581 16 2 1 2579 381947710 381945130 0 4665
2 TraesCS4D01G236200 chr2D 98.527 2579 35 3 1 2579 200950910 200948335 0 4549
3 TraesCS4D01G236200 chr2D 97.867 2579 51 4 1 2579 604432884 604430310 0 4455
4 TraesCS4D01G236200 chr2D 96.084 2579 76 5 1 2579 291465449 291468002 0 4180
5 TraesCS4D01G236200 chr2B 97.983 1785 35 1 795 2579 751961014 751959231 0 3096
6 TraesCS4D01G236200 chr6B 97.927 1785 36 1 795 2578 388166197 388164413 0 3090
7 TraesCS4D01G236200 chr6B 97.816 1786 38 1 795 2579 388358249 388356464 0 3081
8 TraesCS4D01G236200 chr7A 97.762 1787 32 6 795 2579 708263834 708262054 0 3072
9 TraesCS4D01G236200 chr7A 97.410 1004 24 2 1 1004 70504277 70503276 0 1709
10 TraesCS4D01G236200 chr7A 97.677 990 21 1 1 988 60196473 60195484 0 1700
11 TraesCS4D01G236200 chr7B 97.595 1788 43 0 792 2579 531995723 531997510 0 3064
12 TraesCS4D01G236200 chr5B 97.879 990 19 1 1 988 130585044 130584055 0 1711
13 TraesCS4D01G236200 chr5A 97.677 990 21 1 1 988 420172469 420173458 0 1700
14 TraesCS4D01G236200 chr1B 97.677 990 21 1 1 988 619179204 619178215 0 1700


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G236200 chr4D 398048926 398051504 2578 True 4763 4763 100.000 1 2579 1 chr4D.!!$R1 2578
1 TraesCS4D01G236200 chr7D 381945130 381947710 2580 True 4665 4665 99.303 1 2579 1 chr7D.!!$R1 2578
2 TraesCS4D01G236200 chr2D 200948335 200950910 2575 True 4549 4549 98.527 1 2579 1 chr2D.!!$R1 2578
3 TraesCS4D01G236200 chr2D 604430310 604432884 2574 True 4455 4455 97.867 1 2579 1 chr2D.!!$R2 2578
4 TraesCS4D01G236200 chr2D 291465449 291468002 2553 False 4180 4180 96.084 1 2579 1 chr2D.!!$F1 2578
5 TraesCS4D01G236200 chr2B 751959231 751961014 1783 True 3096 3096 97.983 795 2579 1 chr2B.!!$R1 1784
6 TraesCS4D01G236200 chr6B 388164413 388166197 1784 True 3090 3090 97.927 795 2578 1 chr6B.!!$R1 1783
7 TraesCS4D01G236200 chr6B 388356464 388358249 1785 True 3081 3081 97.816 795 2579 1 chr6B.!!$R2 1784
8 TraesCS4D01G236200 chr7A 708262054 708263834 1780 True 3072 3072 97.762 795 2579 1 chr7A.!!$R3 1784
9 TraesCS4D01G236200 chr7A 70503276 70504277 1001 True 1709 1709 97.410 1 1004 1 chr7A.!!$R2 1003
10 TraesCS4D01G236200 chr7A 60195484 60196473 989 True 1700 1700 97.677 1 988 1 chr7A.!!$R1 987
11 TraesCS4D01G236200 chr7B 531995723 531997510 1787 False 3064 3064 97.595 792 2579 1 chr7B.!!$F1 1787
12 TraesCS4D01G236200 chr5B 130584055 130585044 989 True 1711 1711 97.879 1 988 1 chr5B.!!$R1 987
13 TraesCS4D01G236200 chr5A 420172469 420173458 989 False 1700 1700 97.677 1 988 1 chr5A.!!$F1 987
14 TraesCS4D01G236200 chr1B 619178215 619179204 989 True 1700 1700 97.677 1 988 1 chr1B.!!$R1 987

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
128 129 0.905357 GCTAGTTCCAGGGAAGCTGA 59.095 55.0 0.0 0.0 34.49 4.26 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2158 2168 6.151144 AGTGCCAAAGCGAAAATAGAGTAAAT 59.849 34.615 0.0 0.0 44.31 1.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
128 129 0.905357 GCTAGTTCCAGGGAAGCTGA 59.095 55.000 0.00 0.0 34.49 4.26
698 701 1.339247 ACCGGTCCGTCAATAAATGCA 60.339 47.619 11.06 0.0 0.00 3.96
2158 2168 5.163499 ACCCTTGCATTTCGTTCTTTTGTTA 60.163 36.000 0.00 0.0 0.00 2.41
2316 2326 3.947612 AGACTAGAACTACCCGATCCA 57.052 47.619 0.00 0.0 0.00 3.41
2319 2329 5.209659 AGACTAGAACTACCCGATCCATTT 58.790 41.667 0.00 0.0 0.00 2.32
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
128 129 4.098894 AGGCAATCCAACTTCCATTGAAT 58.901 39.130 0.00 0.00 30.31 2.57
807 810 3.320129 TGGCCGGGAATAAGTACCTATT 58.680 45.455 2.18 0.00 0.00 1.73
2158 2168 6.151144 AGTGCCAAAGCGAAAATAGAGTAAAT 59.849 34.615 0.00 0.00 44.31 1.40
2316 2326 7.706179 TCCGTTTCCTTCGTATCGTATTTAAAT 59.294 33.333 5.89 5.89 0.00 1.40
2319 2329 5.971202 GTCCGTTTCCTTCGTATCGTATTTA 59.029 40.000 0.00 0.00 0.00 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.