Multiple sequence alignment - TraesCS4D01G230900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G230900 chr4D 100.000 2752 0 0 1 2752 390855329 390858080 0.000000e+00 5083
1 TraesCS4D01G230900 chr4D 91.727 2780 175 13 1 2750 338021553 338024307 0.000000e+00 3808
2 TraesCS4D01G230900 chr4D 97.955 1516 22 1 1244 2750 448506368 448504853 0.000000e+00 2619
3 TraesCS4D01G230900 chr4D 98.077 1248 24 0 1 1248 448516383 448515136 0.000000e+00 2172
4 TraesCS4D01G230900 chr4D 90.162 864 69 2 2 849 102600741 102599878 0.000000e+00 1110
5 TraesCS4D01G230900 chr5B 90.217 2811 210 32 1 2752 518809084 518806280 0.000000e+00 3607
6 TraesCS4D01G230900 chr5B 88.786 2158 186 20 626 2752 138343380 138345512 0.000000e+00 2593
7 TraesCS4D01G230900 chr5B 87.244 1027 95 13 1753 2749 351104045 351105065 0.000000e+00 1138
8 TraesCS4D01G230900 chr1B 88.989 2788 262 19 1 2752 617808233 617805455 0.000000e+00 3406
9 TraesCS4D01G230900 chr1A 89.562 2692 224 23 1 2652 112046045 112043371 0.000000e+00 3362
10 TraesCS4D01G230900 chr3B 88.917 2797 215 39 15 2751 128576029 128578790 0.000000e+00 3360
11 TraesCS4D01G230900 chr1D 88.681 2518 223 32 258 2744 343260012 343262498 0.000000e+00 3014
12 TraesCS4D01G230900 chr1D 90.147 1705 131 8 2 1678 394561599 394559904 0.000000e+00 2183
13 TraesCS4D01G230900 chr2B 91.179 1950 148 7 606 2533 450716276 450718223 0.000000e+00 2627
14 TraesCS4D01G230900 chr5D 88.974 2086 197 11 683 2752 239968686 239966618 0.000000e+00 2547
15 TraesCS4D01G230900 chr5D 90.038 1044 78 10 1 1030 426703666 426704697 0.000000e+00 1328
16 TraesCS4D01G230900 chr6D 82.249 2828 338 78 1 2752 91236853 91239592 0.000000e+00 2290
17 TraesCS4D01G230900 chr4A 91.235 1620 109 5 277 1865 6628646 6630263 0.000000e+00 2174
18 TraesCS4D01G230900 chr4A 90.551 889 79 5 1867 2752 6632016 6632902 0.000000e+00 1171
19 TraesCS4D01G230900 chr4A 89.325 918 83 12 49 962 710513265 710514171 0.000000e+00 1138
20 TraesCS4D01G230900 chr6A 92.544 1301 89 5 253 1551 501466905 501468199 0.000000e+00 1858
21 TraesCS4D01G230900 chr4B 91.535 886 70 5 1870 2752 559871761 559870878 0.000000e+00 1216
22 TraesCS4D01G230900 chr7A 92.517 147 11 0 2603 2749 436782853 436782999 7.720000e-51 211
23 TraesCS4D01G230900 chr7A 89.333 150 11 4 2603 2752 592207167 592207023 1.680000e-42 183


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G230900 chr4D 390855329 390858080 2751 False 5083.0 5083 100.000 1 2752 1 chr4D.!!$F2 2751
1 TraesCS4D01G230900 chr4D 338021553 338024307 2754 False 3808.0 3808 91.727 1 2750 1 chr4D.!!$F1 2749
2 TraesCS4D01G230900 chr4D 448504853 448506368 1515 True 2619.0 2619 97.955 1244 2750 1 chr4D.!!$R2 1506
3 TraesCS4D01G230900 chr4D 448515136 448516383 1247 True 2172.0 2172 98.077 1 1248 1 chr4D.!!$R3 1247
4 TraesCS4D01G230900 chr4D 102599878 102600741 863 True 1110.0 1110 90.162 2 849 1 chr4D.!!$R1 847
5 TraesCS4D01G230900 chr5B 518806280 518809084 2804 True 3607.0 3607 90.217 1 2752 1 chr5B.!!$R1 2751
6 TraesCS4D01G230900 chr5B 138343380 138345512 2132 False 2593.0 2593 88.786 626 2752 1 chr5B.!!$F1 2126
7 TraesCS4D01G230900 chr5B 351104045 351105065 1020 False 1138.0 1138 87.244 1753 2749 1 chr5B.!!$F2 996
8 TraesCS4D01G230900 chr1B 617805455 617808233 2778 True 3406.0 3406 88.989 1 2752 1 chr1B.!!$R1 2751
9 TraesCS4D01G230900 chr1A 112043371 112046045 2674 True 3362.0 3362 89.562 1 2652 1 chr1A.!!$R1 2651
10 TraesCS4D01G230900 chr3B 128576029 128578790 2761 False 3360.0 3360 88.917 15 2751 1 chr3B.!!$F1 2736
11 TraesCS4D01G230900 chr1D 343260012 343262498 2486 False 3014.0 3014 88.681 258 2744 1 chr1D.!!$F1 2486
12 TraesCS4D01G230900 chr1D 394559904 394561599 1695 True 2183.0 2183 90.147 2 1678 1 chr1D.!!$R1 1676
13 TraesCS4D01G230900 chr2B 450716276 450718223 1947 False 2627.0 2627 91.179 606 2533 1 chr2B.!!$F1 1927
14 TraesCS4D01G230900 chr5D 239966618 239968686 2068 True 2547.0 2547 88.974 683 2752 1 chr5D.!!$R1 2069
15 TraesCS4D01G230900 chr5D 426703666 426704697 1031 False 1328.0 1328 90.038 1 1030 1 chr5D.!!$F1 1029
16 TraesCS4D01G230900 chr6D 91236853 91239592 2739 False 2290.0 2290 82.249 1 2752 1 chr6D.!!$F1 2751
17 TraesCS4D01G230900 chr4A 6628646 6632902 4256 False 1672.5 2174 90.893 277 2752 2 chr4A.!!$F2 2475
18 TraesCS4D01G230900 chr4A 710513265 710514171 906 False 1138.0 1138 89.325 49 962 1 chr4A.!!$F1 913
19 TraesCS4D01G230900 chr6A 501466905 501468199 1294 False 1858.0 1858 92.544 253 1551 1 chr6A.!!$F1 1298
20 TraesCS4D01G230900 chr4B 559870878 559871761 883 True 1216.0 1216 91.535 1870 2752 1 chr4B.!!$R1 882

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
809 966 1.672356 GTCAGGCCATCGTGCTGTT 60.672 57.895 5.01 0.0 0.0 3.16 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2623 4610 0.380733 CTCGCATTGCATGTGCTCAT 59.619 50.0 18.72 0.0 42.66 2.9 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
144 156 2.408271 TCGGTCGGCCTATATATCGT 57.592 50.000 3.66 0.0 0.00 3.73
809 966 1.672356 GTCAGGCCATCGTGCTGTT 60.672 57.895 5.01 0.0 0.00 3.16
1324 1498 4.022068 CACAAACCATGCCATTCTAACAGT 60.022 41.667 0.00 0.0 0.00 3.55
1405 1583 2.449967 TAGGCTCACCCCAAGGACGA 62.450 60.000 0.00 0.0 36.11 4.20
1412 1590 1.064825 ACCCCAAGGACGATGAGTTT 58.935 50.000 0.00 0.0 36.73 2.66
2290 4261 3.450096 GGTGTTCGAAGGTAGGGTTCTAT 59.550 47.826 0.00 0.0 0.00 1.98
2472 4449 1.134788 CGACCGTTAGGGCTGAAGAAT 60.135 52.381 0.00 0.0 45.93 2.40
2525 4502 2.899838 GCTGTGGCGTTGGTGTGA 60.900 61.111 0.00 0.0 0.00 3.58
2529 4506 1.959226 GTGGCGTTGGTGTGATCGT 60.959 57.895 0.00 0.0 0.00 3.73
2530 4507 1.958715 TGGCGTTGGTGTGATCGTG 60.959 57.895 0.00 0.0 0.00 4.35
2532 4509 1.204062 GCGTTGGTGTGATCGTGTG 59.796 57.895 0.00 0.0 0.00 3.82
2533 4510 1.495584 GCGTTGGTGTGATCGTGTGT 61.496 55.000 0.00 0.0 0.00 3.72
2536 4513 2.154963 CGTTGGTGTGATCGTGTGTAAG 59.845 50.000 0.00 0.0 0.00 2.34
2541 4518 4.218852 TGGTGTGATCGTGTGTAAGATGTA 59.781 41.667 0.00 0.0 0.00 2.29
2542 4519 4.798907 GGTGTGATCGTGTGTAAGATGTAG 59.201 45.833 0.00 0.0 0.00 2.74
2543 4520 5.399858 GTGTGATCGTGTGTAAGATGTAGT 58.600 41.667 0.00 0.0 0.00 2.73
2547 4525 7.550196 TGTGATCGTGTGTAAGATGTAGTAGTA 59.450 37.037 0.00 0.0 0.00 1.82
2623 4610 1.437772 CCAAACAACGTGCACCCGTA 61.438 55.000 12.15 0.0 40.85 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
81 93 1.892862 TCCCGCCGCTTTTTCGAAA 60.893 52.632 6.47 6.47 0.00 3.46
272 286 0.544697 GAGAGGAGGAGGAGTCGACT 59.455 60.000 20.18 20.18 0.00 4.18
809 966 3.760035 GCGGGAACTGGCTCTCGA 61.760 66.667 5.59 0.00 42.10 4.04
1160 1332 2.800544 CACTTTCTCAGGTGGTTGTACG 59.199 50.000 0.00 0.00 0.00 3.67
1324 1498 1.908619 TCATAGGCTTGAACTGCTGGA 59.091 47.619 0.00 0.00 0.00 3.86
1405 1583 1.645710 AGGGGTGTCGAGAAACTCAT 58.354 50.000 0.00 0.00 0.00 2.90
1412 1590 0.924090 TCTGGATAGGGGTGTCGAGA 59.076 55.000 0.00 0.00 0.00 4.04
1922 3856 1.572085 ATCGTCGTCGTCCTTGTCGT 61.572 55.000 1.33 0.00 38.33 4.34
2290 4261 3.761897 CTTCCCATGAACTGTAAACCCA 58.238 45.455 0.00 0.00 0.00 4.51
2472 4449 7.094248 ACAATGAATTGGACGAAGATGATGAAA 60.094 33.333 7.87 0.00 41.96 2.69
2525 4502 8.350722 CCAATACTACTACATCTTACACACGAT 58.649 37.037 0.00 0.00 0.00 3.73
2530 4507 9.460906 GCTTACCAATACTACTACATCTTACAC 57.539 37.037 0.00 0.00 0.00 2.90
2532 4509 9.896263 GAGCTTACCAATACTACTACATCTTAC 57.104 37.037 0.00 0.00 0.00 2.34
2533 4510 9.636789 TGAGCTTACCAATACTACTACATCTTA 57.363 33.333 0.00 0.00 0.00 2.10
2536 4513 7.146648 GGTGAGCTTACCAATACTACTACATC 58.853 42.308 22.15 0.00 40.54 3.06
2623 4610 0.380733 CTCGCATTGCATGTGCTCAT 59.619 50.000 18.72 0.00 42.66 2.90


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.