Multiple sequence alignment - TraesCS4D01G218500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G218500 chr4D 100.000 3116 0 0 1 3116 374040540 374043655 0.000000e+00 5755
1 TraesCS4D01G218500 chr4D 90.093 646 53 3 1 636 98014568 98015212 0.000000e+00 828
2 TraesCS4D01G218500 chr4D 81.679 655 91 16 1 636 435197905 435198549 4.610000e-143 518
3 TraesCS4D01G218500 chr5D 97.746 2485 51 4 636 3116 430991431 430988948 0.000000e+00 4274
4 TraesCS4D01G218500 chr7D 96.713 2495 56 10 636 3116 550878352 550880834 0.000000e+00 4130
5 TraesCS4D01G218500 chr6D 96.661 2486 57 5 636 3116 57832587 57835051 0.000000e+00 4108
6 TraesCS4D01G218500 chr6D 96.498 2484 63 4 636 3116 448503569 448501107 0.000000e+00 4084
7 TraesCS4D01G218500 chr6D 96.834 1769 32 3 1349 3116 464130027 464131772 0.000000e+00 2935
8 TraesCS4D01G218500 chr1D 96.620 2485 58 6 636 3116 479819307 479816845 0.000000e+00 4100
9 TraesCS4D01G218500 chr1D 96.579 2485 60 4 636 3116 442318422 442320885 0.000000e+00 4095
10 TraesCS4D01G218500 chr2D 95.895 2485 65 17 636 3116 499310618 499313069 0.000000e+00 3989
11 TraesCS4D01G218500 chrUn 97.826 2300 45 5 666 2960 26236268 26233969 0.000000e+00 3965
12 TraesCS4D01G218500 chrUn 98.456 518 6 2 2444 2960 244894172 244893656 0.000000e+00 911
13 TraesCS4D01G218500 chr3D 95.654 2485 65 7 635 3116 550468215 550465771 0.000000e+00 3951
14 TraesCS4D01G218500 chr3D 81.887 657 95 11 1 636 533959046 533959699 1.650000e-147 532
15 TraesCS4D01G218500 chr3B 97.460 945 24 0 2172 3116 809209286 809208342 0.000000e+00 1613
16 TraesCS4D01G218500 chr3B 82.927 656 90 12 1 636 706027848 706028501 3.490000e-159 571
17 TraesCS4D01G218500 chr4B 95.775 639 23 2 1 636 460155774 460156411 0.000000e+00 1027
18 TraesCS4D01G218500 chr4B 89.466 655 48 8 1 636 139592802 139593454 0.000000e+00 808
19 TraesCS4D01G218500 chr4A 95.133 637 26 3 4 636 90440299 90439664 0.000000e+00 1000
20 TraesCS4D01G218500 chr4A 90.352 653 45 6 1 636 478192270 478191619 0.000000e+00 841
21 TraesCS4D01G218500 chr4A 81.402 656 91 19 1 636 36606927 36607571 9.970000e-140 507


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G218500 chr4D 374040540 374043655 3115 False 5755 5755 100.000 1 3116 1 chr4D.!!$F2 3115
1 TraesCS4D01G218500 chr4D 98014568 98015212 644 False 828 828 90.093 1 636 1 chr4D.!!$F1 635
2 TraesCS4D01G218500 chr4D 435197905 435198549 644 False 518 518 81.679 1 636 1 chr4D.!!$F3 635
3 TraesCS4D01G218500 chr5D 430988948 430991431 2483 True 4274 4274 97.746 636 3116 1 chr5D.!!$R1 2480
4 TraesCS4D01G218500 chr7D 550878352 550880834 2482 False 4130 4130 96.713 636 3116 1 chr7D.!!$F1 2480
5 TraesCS4D01G218500 chr6D 57832587 57835051 2464 False 4108 4108 96.661 636 3116 1 chr6D.!!$F1 2480
6 TraesCS4D01G218500 chr6D 448501107 448503569 2462 True 4084 4084 96.498 636 3116 1 chr6D.!!$R1 2480
7 TraesCS4D01G218500 chr6D 464130027 464131772 1745 False 2935 2935 96.834 1349 3116 1 chr6D.!!$F2 1767
8 TraesCS4D01G218500 chr1D 479816845 479819307 2462 True 4100 4100 96.620 636 3116 1 chr1D.!!$R1 2480
9 TraesCS4D01G218500 chr1D 442318422 442320885 2463 False 4095 4095 96.579 636 3116 1 chr1D.!!$F1 2480
10 TraesCS4D01G218500 chr2D 499310618 499313069 2451 False 3989 3989 95.895 636 3116 1 chr2D.!!$F1 2480
11 TraesCS4D01G218500 chrUn 26233969 26236268 2299 True 3965 3965 97.826 666 2960 1 chrUn.!!$R1 2294
12 TraesCS4D01G218500 chrUn 244893656 244894172 516 True 911 911 98.456 2444 2960 1 chrUn.!!$R2 516
13 TraesCS4D01G218500 chr3D 550465771 550468215 2444 True 3951 3951 95.654 635 3116 1 chr3D.!!$R1 2481
14 TraesCS4D01G218500 chr3D 533959046 533959699 653 False 532 532 81.887 1 636 1 chr3D.!!$F1 635
15 TraesCS4D01G218500 chr3B 809208342 809209286 944 True 1613 1613 97.460 2172 3116 1 chr3B.!!$R1 944
16 TraesCS4D01G218500 chr3B 706027848 706028501 653 False 571 571 82.927 1 636 1 chr3B.!!$F1 635
17 TraesCS4D01G218500 chr4B 460155774 460156411 637 False 1027 1027 95.775 1 636 1 chr4B.!!$F2 635
18 TraesCS4D01G218500 chr4B 139592802 139593454 652 False 808 808 89.466 1 636 1 chr4B.!!$F1 635
19 TraesCS4D01G218500 chr4A 90439664 90440299 635 True 1000 1000 95.133 4 636 1 chr4A.!!$R1 632
20 TraesCS4D01G218500 chr4A 478191619 478192270 651 True 841 841 90.352 1 636 1 chr4A.!!$R2 635
21 TraesCS4D01G218500 chr4A 36606927 36607571 644 False 507 507 81.402 1 636 1 chr4A.!!$F1 635

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
950 1001 0.596577 CTCACTCGTTTCCTCCGTCA 59.403 55.0 0.0 0.0 0.0 4.35 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2387 2444 0.388907 CCCAAAAGGTCAGCAATGCG 60.389 55.0 0.0 0.0 0.0 4.73 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
152 171 4.522789 ACGCACCCAATTAAGACAAGAAAT 59.477 37.500 0.00 0.00 0.00 2.17
177 197 3.676172 CACACATTTGCATTGATCGCTTT 59.324 39.130 4.32 0.00 0.00 3.51
190 211 8.482429 GCATTGATCGCTTTAGGAATTTAAATG 58.518 33.333 0.39 0.00 0.00 2.32
324 359 1.000060 CACCTTGGTGAAGTTGCCATG 60.000 52.381 14.15 0.00 34.37 3.66
676 715 2.027007 CCACAATTGGGGCATCAAATGT 60.027 45.455 15.25 7.42 40.24 2.71
719 758 5.789643 AATTTTTGCATGTCAGTACCACT 57.210 34.783 0.00 0.00 0.00 4.00
751 791 8.655901 TCCAGGTTTTTCAAATAAGGCTAAAAT 58.344 29.630 0.00 0.00 0.00 1.82
950 1001 0.596577 CTCACTCGTTTCCTCCGTCA 59.403 55.000 0.00 0.00 0.00 4.35
1015 1066 0.893270 CGCCATGGTTTTGGAGGACA 60.893 55.000 14.67 0.00 39.25 4.02
1066 1117 3.159213 ACATGCATTCTTCCTCCACAA 57.841 42.857 0.00 0.00 0.00 3.33
1111 1162 5.103813 ACAGTGAGTTTAGGGTTAGGGTTTT 60.104 40.000 0.00 0.00 0.00 2.43
1181 1232 2.287788 CCATTGTCTTTGTGCGAGCTTT 60.288 45.455 0.00 0.00 0.00 3.51
1330 1381 2.736978 CGGTTTTTAGCATGTGCACAA 58.263 42.857 25.72 3.79 45.16 3.33
1435 1489 7.010923 GCTTGTTGTCAACATTTTGGTTCATAA 59.989 33.333 18.83 0.00 41.79 1.90
1571 1627 2.558795 GTCAGTCAGCTACTCAAGTGGA 59.441 50.000 0.00 0.00 35.76 4.02
1665 1721 9.607285 CTTGTGTAATTACTTGTTGTATGAACC 57.393 33.333 16.33 0.00 0.00 3.62
1834 1890 7.475015 TGACAATCTTGAAAGTTCTTTCACTG 58.525 34.615 22.33 18.22 40.29 3.66
1953 2009 3.084039 GGTGGATTTCAGACATCTGCAA 58.916 45.455 3.88 0.03 43.46 4.08
2113 2169 3.484407 AGAGCTCAAGCAACAGTCATTT 58.516 40.909 17.77 0.00 45.16 2.32
2179 2235 6.352516 ACTGAAGCTAGTATGAATTTGGAGG 58.647 40.000 0.00 0.00 0.00 4.30
2486 2543 6.308015 TGTACTAATGGTGAACTATGGCTT 57.692 37.500 0.00 0.00 0.00 4.35
2890 2947 6.044682 GCATTTAGATTGGCTGCAACTAAAT 58.955 36.000 17.71 17.71 41.37 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
91 92 0.838122 CTGGGTCAAGGGTGAGTCCT 60.838 60.000 0.00 0.00 39.17 3.85
152 171 4.336153 AGCGATCAATGCAAATGTGTGATA 59.664 37.500 0.00 0.00 33.85 2.15
190 211 3.511146 TGCCTCATCTTTCCATTTGTTCC 59.489 43.478 0.00 0.00 0.00 3.62
195 223 3.463048 AGGTGCCTCATCTTTCCATTT 57.537 42.857 0.00 0.00 0.00 2.32
672 711 4.574828 GCAATCGTGGTACCAATCTACATT 59.425 41.667 18.31 5.86 0.00 2.71
676 715 5.601583 TTAGCAATCGTGGTACCAATCTA 57.398 39.130 18.31 8.75 37.45 1.98
719 758 7.610865 CCTTATTTGAAAAACCTGGAGCAATA 58.389 34.615 0.00 0.00 0.00 1.90
865 916 3.081409 CCGGACCGGGTTGGAGAT 61.081 66.667 26.15 0.00 44.15 2.75
1015 1066 1.222115 GACTGGTCGTCGCTGCTTTT 61.222 55.000 0.00 0.00 32.04 2.27
1066 1117 0.314302 CTGACCTCGTTGAGACCGTT 59.686 55.000 0.00 0.00 0.00 4.44
1111 1162 8.313292 CAACCAAATCAAGAAATCCCAAATCTA 58.687 33.333 0.00 0.00 0.00 1.98
1181 1232 0.112995 AGGCTGAAAGGGACATGCAA 59.887 50.000 0.00 0.00 0.00 4.08
1186 1237 1.774254 TCTTCAAGGCTGAAAGGGACA 59.226 47.619 8.72 0.00 41.05 4.02
1330 1381 1.502690 TGCCTACAATCCATACCGGT 58.497 50.000 13.98 13.98 35.57 5.28
1435 1489 6.555360 ACCTAAATAAGCTACTCTAGTGCCAT 59.445 38.462 0.00 0.00 0.00 4.40
1571 1627 5.882557 CCACTACATTTAACAAGAGGAGCAT 59.117 40.000 0.00 0.00 0.00 3.79
1665 1721 2.339728 ACAACAACAACACCAACACG 57.660 45.000 0.00 0.00 0.00 4.49
1834 1890 2.828520 TCTCTTCTGTCAGATGGTGGAC 59.171 50.000 14.07 0.00 34.63 4.02
1953 2009 4.287845 TCCTGCTGATATGTAATGGCAGAT 59.712 41.667 13.27 0.00 46.65 2.90
2076 2132 2.540265 CTCTTGTCAGGTTGAGCAGT 57.460 50.000 0.00 0.00 0.00 4.40
2179 2235 5.049129 ACTTTGTTAGCTCTGCATTCTTCAC 60.049 40.000 0.00 0.00 0.00 3.18
2387 2444 0.388907 CCCAAAAGGTCAGCAATGCG 60.389 55.000 0.00 0.00 0.00 4.73


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.