Multiple sequence alignment - TraesCS4D01G201500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G201500 chr4D 100.000 2493 0 0 1 2493 348405890 348403398 0 4604
1 TraesCS4D01G201500 chr4D 97.438 2498 57 7 1 2493 504400318 504397823 0 4252
2 TraesCS4D01G201500 chr4D 95.618 2510 91 17 1 2493 178587366 178584859 0 4008
3 TraesCS4D01G201500 chr3D 97.673 2493 57 1 1 2493 588800970 588798479 0 4281
4 TraesCS4D01G201500 chr3D 97.233 2494 63 6 1 2493 478614215 478616703 0 4218
5 TraesCS4D01G201500 chr5D 97.275 2495 62 5 3 2493 45854581 45857073 0 4226
6 TraesCS4D01G201500 chr6D 97.119 2499 62 9 1 2493 176859184 176861678 0 4207
7 TraesCS4D01G201500 chr7D 97.078 2498 67 5 1 2493 313362164 313359668 0 4204
8 TraesCS4D01G201500 chr2D 96.840 2500 69 9 1 2493 460887120 460884624 0 4170
9 TraesCS4D01G201500 chr2D 94.287 2503 118 18 1 2493 412482563 412485050 0 3807


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G201500 chr4D 348403398 348405890 2492 True 4604 4604 100.000 1 2493 1 chr4D.!!$R2 2492
1 TraesCS4D01G201500 chr4D 504397823 504400318 2495 True 4252 4252 97.438 1 2493 1 chr4D.!!$R3 2492
2 TraesCS4D01G201500 chr4D 178584859 178587366 2507 True 4008 4008 95.618 1 2493 1 chr4D.!!$R1 2492
3 TraesCS4D01G201500 chr3D 588798479 588800970 2491 True 4281 4281 97.673 1 2493 1 chr3D.!!$R1 2492
4 TraesCS4D01G201500 chr3D 478614215 478616703 2488 False 4218 4218 97.233 1 2493 1 chr3D.!!$F1 2492
5 TraesCS4D01G201500 chr5D 45854581 45857073 2492 False 4226 4226 97.275 3 2493 1 chr5D.!!$F1 2490
6 TraesCS4D01G201500 chr6D 176859184 176861678 2494 False 4207 4207 97.119 1 2493 1 chr6D.!!$F1 2492
7 TraesCS4D01G201500 chr7D 313359668 313362164 2496 True 4204 4204 97.078 1 2493 1 chr7D.!!$R1 2492
8 TraesCS4D01G201500 chr2D 460884624 460887120 2496 True 4170 4170 96.840 1 2493 1 chr2D.!!$R1 2492
9 TraesCS4D01G201500 chr2D 412482563 412485050 2487 False 3807 3807 94.287 1 2493 1 chr2D.!!$F1 2492

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
58 59 0.388520 CGCGGATGATTATGAGCCGA 60.389 55.0 13.12 0.0 44.43 5.54 F
167 168 2.787723 CTGAAAGCGTAATGACCACG 57.212 50.0 0.00 0.0 42.24 4.94 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1228 1241 0.460284 CCTTGCTTCGTAGTCGCCAT 60.460 55.000 0.00 0.0 36.96 4.4 R
1511 1529 1.532007 GTTGGACCGCGTGTTGAAATA 59.468 47.619 4.92 0.0 0.00 1.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 0.388520 CGCGGATGATTATGAGCCGA 60.389 55.000 13.12 0.0 44.43 5.54
167 168 2.787723 CTGAAAGCGTAATGACCACG 57.212 50.000 0.00 0.0 42.24 4.94
896 908 3.071747 TCATGTGCCTGTTAGTGTAACCA 59.928 43.478 0.00 0.0 37.80 3.67
938 950 8.956426 GTCATTTTCCCAACTACATCATTTCTA 58.044 33.333 0.00 0.0 0.00 2.10
1177 1190 4.141390 ACAACCTCAAAGAGACATGGAACT 60.141 41.667 0.00 0.0 0.00 3.01
1228 1241 7.884877 AGATCAGACATTTTCCAATTGAGTACA 59.115 33.333 7.12 0.0 0.00 2.90
1393 1411 2.902705 TCTTGTTTAGGCACGACTGT 57.097 45.000 0.00 0.0 0.00 3.55
1492 1510 3.505680 AGCTCCGCAAAATTTACACATGA 59.494 39.130 0.00 0.0 0.00 3.07
1511 1529 7.094631 CACATGAAACTGGTTGATGAATGAAT 58.905 34.615 11.86 0.0 0.00 2.57
1795 1824 5.483685 ACTTAGGTTTGACAGCAGATACA 57.516 39.130 0.00 0.0 0.00 2.29
1946 1979 5.413309 TCTTTCTTGTTTGGCTTTTTGGA 57.587 34.783 0.00 0.0 0.00 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
58 59 2.452600 TCCTTTGTGGCCTTGACTTT 57.547 45.000 3.32 0.00 35.26 2.66
167 168 3.429410 GCAAATGAGAGGTTTATGTGGGC 60.429 47.826 0.00 0.00 0.00 5.36
438 442 2.158900 CGGGAGACATATCCATATGCCC 60.159 54.545 6.49 8.09 42.98 5.36
609 615 5.454045 GGCAAAAACTTAACATGGGAGGAAA 60.454 40.000 0.00 0.00 0.00 3.13
624 630 3.690460 AGCATAGCTACTGGCAAAAACT 58.310 40.909 14.19 0.00 44.79 2.66
625 632 4.082787 TGAAGCATAGCTACTGGCAAAAAC 60.083 41.667 14.19 4.01 44.79 2.43
896 908 9.125026 GGGAAAATGACATGTAAAGATATCACT 57.875 33.333 5.32 0.00 0.00 3.41
938 950 5.743117 AGAAGCAGAGCTCACATTAAGAAT 58.257 37.500 17.77 0.00 38.25 2.40
1177 1190 5.763204 GGACCTTTGAGTTTTCATAGTGACA 59.237 40.000 0.00 0.00 32.44 3.58
1228 1241 0.460284 CCTTGCTTCGTAGTCGCCAT 60.460 55.000 0.00 0.00 36.96 4.40
1511 1529 1.532007 GTTGGACCGCGTGTTGAAATA 59.468 47.619 4.92 0.00 0.00 1.40
1958 1991 3.510360 CCATGCTAGCCGGTATAGTTAGT 59.490 47.826 13.29 0.00 0.00 2.24
2292 2420 1.167851 GAATAGCTGCAGTTGCCACA 58.832 50.000 16.64 0.00 41.18 4.17


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.