Multiple sequence alignment - TraesCS4D01G201000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G201000 chr4D 100.000 2493 0 0 1 2493 348276168 348273676 0.000000e+00 4604
1 TraesCS4D01G201000 chr4D 93.458 963 51 10 1 958 450002110 450003065 0.000000e+00 1419
2 TraesCS4D01G201000 chr4D 94.363 408 21 1 2088 2493 450006199 450006606 2.110000e-175 625
3 TraesCS4D01G201000 chr4D 91.250 320 25 1 1900 2216 53369609 53369928 1.370000e-117 433
4 TraesCS4D01G201000 chr7D 94.291 1594 73 8 913 2493 379137709 379136121 0.000000e+00 2423
5 TraesCS4D01G201000 chr7D 93.820 1618 79 12 892 2493 255733847 255735459 0.000000e+00 2414
6 TraesCS4D01G201000 chr7D 92.255 1614 83 16 902 2491 574343874 574342279 0.000000e+00 2250
7 TraesCS4D01G201000 chr3D 93.859 1612 80 11 895 2493 43175246 43173641 0.000000e+00 2410
8 TraesCS4D01G201000 chr3D 92.404 1672 105 14 1 1658 377157244 377155581 0.000000e+00 2364
9 TraesCS4D01G201000 chr3D 91.825 1370 84 15 1 1360 558509681 558508330 0.000000e+00 1884
10 TraesCS4D01G201000 chr2D 93.610 1612 76 14 902 2493 49729501 49731105 0.000000e+00 2381
11 TraesCS4D01G201000 chr2D 93.038 1623 84 12 892 2493 49682703 49684317 0.000000e+00 2344
12 TraesCS4D01G201000 chr2D 91.733 1621 82 25 883 2493 444167197 444165619 0.000000e+00 2204
13 TraesCS4D01G201000 chr3B 89.816 1846 141 24 178 2003 21298984 21297166 0.000000e+00 2324
14 TraesCS4D01G201000 chr3B 92.397 605 35 4 1900 2493 669394484 669393880 0.000000e+00 852
15 TraesCS4D01G201000 chr6D 92.890 1519 79 11 892 2386 359516534 359518047 0.000000e+00 2180
16 TraesCS4D01G201000 chr6D 90.485 1650 84 26 895 2493 465237168 465238795 0.000000e+00 2109
17 TraesCS4D01G201000 chr6D 89.375 1327 62 29 1201 2492 126949177 126947895 0.000000e+00 1596
18 TraesCS4D01G201000 chr6D 94.334 353 16 4 2145 2493 214765861 214765509 2.820000e-149 538
19 TraesCS4D01G201000 chr6D 92.138 318 22 3 1900 2216 143365153 143365468 1.760000e-121 446
20 TraesCS4D01G201000 chr6A 90.981 1641 89 24 885 2493 455406021 455407634 0.000000e+00 2156
21 TraesCS4D01G201000 chr6A 91.977 1533 97 18 142 1658 71558197 71556675 0.000000e+00 2126
22 TraesCS4D01G201000 chr6A 92.523 963 61 9 1 958 580452075 580453031 0.000000e+00 1369
23 TraesCS4D01G201000 chr5A 89.206 1612 99 31 895 2493 514304207 514302658 0.000000e+00 1943
24 TraesCS4D01G201000 chr5A 92.220 964 59 11 1 958 595229430 595230383 0.000000e+00 1351
25 TraesCS4D01G201000 chr5A 90.532 602 48 5 1900 2493 703054597 703053997 0.000000e+00 787
26 TraesCS4D01G201000 chr5D 88.789 1329 91 27 892 2209 305543412 305544693 0.000000e+00 1576
27 TraesCS4D01G201000 chr5D 90.802 511 31 7 1998 2493 219869419 219869928 0.000000e+00 669
28 TraesCS4D01G201000 chr5D 96.726 336 10 1 2158 2493 361380785 361381119 2.170000e-155 558
29 TraesCS4D01G201000 chr1D 93.822 955 49 9 1 947 50645681 50646633 0.000000e+00 1428
30 TraesCS4D01G201000 chr1D 92.013 601 36 9 1900 2493 409934004 409933409 0.000000e+00 833
31 TraesCS4D01G201000 chr1D 93.805 339 18 2 2158 2493 250772192 250772530 7.960000e-140 507
32 TraesCS4D01G201000 chr1D 93.769 337 17 3 2160 2493 386743763 386744098 1.030000e-138 503
33 TraesCS4D01G201000 chr1D 93.472 337 19 1 2160 2493 385734297 385733961 4.790000e-137 497
34 TraesCS4D01G201000 chr1D 90.654 321 25 2 1900 2216 385734602 385734283 2.960000e-114 422
35 TraesCS4D01G201000 chr1D 89.720 321 29 1 1900 2216 386743457 386743777 8.300000e-110 407
36 TraesCS4D01G201000 chr6B 92.754 966 58 10 1 958 450669658 450670619 0.000000e+00 1386
37 TraesCS4D01G201000 chr2A 92.384 604 35 3 1900 2493 435085562 435084960 0.000000e+00 850
38 TraesCS4D01G201000 chr7B 92.321 599 40 5 1900 2493 491887589 491888186 0.000000e+00 846


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G201000 chr4D 348273676 348276168 2492 True 4604.0 4604 100.0000 1 2493 1 chr4D.!!$R1 2492
1 TraesCS4D01G201000 chr4D 450002110 450006606 4496 False 1022.0 1419 93.9105 1 2493 2 chr4D.!!$F2 2492
2 TraesCS4D01G201000 chr7D 379136121 379137709 1588 True 2423.0 2423 94.2910 913 2493 1 chr7D.!!$R1 1580
3 TraesCS4D01G201000 chr7D 255733847 255735459 1612 False 2414.0 2414 93.8200 892 2493 1 chr7D.!!$F1 1601
4 TraesCS4D01G201000 chr7D 574342279 574343874 1595 True 2250.0 2250 92.2550 902 2491 1 chr7D.!!$R2 1589
5 TraesCS4D01G201000 chr3D 43173641 43175246 1605 True 2410.0 2410 93.8590 895 2493 1 chr3D.!!$R1 1598
6 TraesCS4D01G201000 chr3D 377155581 377157244 1663 True 2364.0 2364 92.4040 1 1658 1 chr3D.!!$R2 1657
7 TraesCS4D01G201000 chr3D 558508330 558509681 1351 True 1884.0 1884 91.8250 1 1360 1 chr3D.!!$R3 1359
8 TraesCS4D01G201000 chr2D 49729501 49731105 1604 False 2381.0 2381 93.6100 902 2493 1 chr2D.!!$F2 1591
9 TraesCS4D01G201000 chr2D 49682703 49684317 1614 False 2344.0 2344 93.0380 892 2493 1 chr2D.!!$F1 1601
10 TraesCS4D01G201000 chr2D 444165619 444167197 1578 True 2204.0 2204 91.7330 883 2493 1 chr2D.!!$R1 1610
11 TraesCS4D01G201000 chr3B 21297166 21298984 1818 True 2324.0 2324 89.8160 178 2003 1 chr3B.!!$R1 1825
12 TraesCS4D01G201000 chr3B 669393880 669394484 604 True 852.0 852 92.3970 1900 2493 1 chr3B.!!$R2 593
13 TraesCS4D01G201000 chr6D 359516534 359518047 1513 False 2180.0 2180 92.8900 892 2386 1 chr6D.!!$F2 1494
14 TraesCS4D01G201000 chr6D 465237168 465238795 1627 False 2109.0 2109 90.4850 895 2493 1 chr6D.!!$F3 1598
15 TraesCS4D01G201000 chr6D 126947895 126949177 1282 True 1596.0 1596 89.3750 1201 2492 1 chr6D.!!$R1 1291
16 TraesCS4D01G201000 chr6A 455406021 455407634 1613 False 2156.0 2156 90.9810 885 2493 1 chr6A.!!$F1 1608
17 TraesCS4D01G201000 chr6A 71556675 71558197 1522 True 2126.0 2126 91.9770 142 1658 1 chr6A.!!$R1 1516
18 TraesCS4D01G201000 chr6A 580452075 580453031 956 False 1369.0 1369 92.5230 1 958 1 chr6A.!!$F2 957
19 TraesCS4D01G201000 chr5A 514302658 514304207 1549 True 1943.0 1943 89.2060 895 2493 1 chr5A.!!$R1 1598
20 TraesCS4D01G201000 chr5A 595229430 595230383 953 False 1351.0 1351 92.2200 1 958 1 chr5A.!!$F1 957
21 TraesCS4D01G201000 chr5A 703053997 703054597 600 True 787.0 787 90.5320 1900 2493 1 chr5A.!!$R2 593
22 TraesCS4D01G201000 chr5D 305543412 305544693 1281 False 1576.0 1576 88.7890 892 2209 1 chr5D.!!$F2 1317
23 TraesCS4D01G201000 chr5D 219869419 219869928 509 False 669.0 669 90.8020 1998 2493 1 chr5D.!!$F1 495
24 TraesCS4D01G201000 chr1D 50645681 50646633 952 False 1428.0 1428 93.8220 1 947 1 chr1D.!!$F1 946
25 TraesCS4D01G201000 chr1D 409933409 409934004 595 True 833.0 833 92.0130 1900 2493 1 chr1D.!!$R1 593
26 TraesCS4D01G201000 chr1D 385733961 385734602 641 True 459.5 497 92.0630 1900 2493 2 chr1D.!!$R2 593
27 TraesCS4D01G201000 chr1D 386743457 386744098 641 False 455.0 503 91.7445 1900 2493 2 chr1D.!!$F3 593
28 TraesCS4D01G201000 chr6B 450669658 450670619 961 False 1386.0 1386 92.7540 1 958 1 chr6B.!!$F1 957
29 TraesCS4D01G201000 chr2A 435084960 435085562 602 True 850.0 850 92.3840 1900 2493 1 chr2A.!!$R1 593
30 TraesCS4D01G201000 chr7B 491887589 491888186 597 False 846.0 846 92.3210 1900 2493 1 chr7B.!!$F1 593

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
675 699 0.593128 CCCGTTGACCAGCTCAAAAG 59.407 55.0 0.0 0.0 40.73 2.27 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1788 1933 1.077429 GGCCCAACCAGAGCTTAGG 60.077 63.158 0.0 4.01 38.86 2.69 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
49 50 5.404096 GGTAAACAACCCCATTTGTAATCG 58.596 41.667 0.00 0.00 43.16 3.34
335 345 2.390696 GAAACCCTACCTCCTCTCCTC 58.609 57.143 0.00 0.00 0.00 3.71
345 355 3.791545 ACCTCCTCTCCTCAGTCTCTATT 59.208 47.826 0.00 0.00 0.00 1.73
467 478 9.189156 AGACAACATTGTGCATAGGTTTTATAT 57.811 29.630 1.07 0.00 42.43 0.86
518 532 1.008309 GACCTCGATCGTGCTAGCC 60.008 63.158 15.94 2.49 0.00 3.93
521 538 1.448119 CCTCGATCGTGCTAGCCAGA 61.448 60.000 15.94 11.94 0.00 3.86
675 699 0.593128 CCCGTTGACCAGCTCAAAAG 59.407 55.000 0.00 0.00 40.73 2.27
787 811 8.248645 AGATGTGGTCTTCTAGAAGGAATTCCT 61.249 40.741 28.09 21.89 40.74 3.36
858 882 2.665089 ATCGTTGGATCGTGGGGCA 61.665 57.895 0.00 0.00 0.00 5.36
877 901 1.298859 AATCCGCGAGACTTGTTGGC 61.299 55.000 8.23 0.00 0.00 4.52
928 993 3.444805 AGCGACGAGAGGAGCCAC 61.445 66.667 0.00 0.00 38.15 5.01
929 994 3.444805 GCGACGAGAGGAGCCACT 61.445 66.667 0.00 0.00 0.00 4.00
930 995 2.795297 CGACGAGAGGAGCCACTC 59.205 66.667 4.14 4.14 37.77 3.51
1046 1113 2.887568 GCGATGTCCTGACTGCCG 60.888 66.667 0.00 1.43 0.00 5.69
1167 1235 9.393512 CAGGTTAGATCTCATGATTTTTCTCTT 57.606 33.333 0.00 0.00 32.19 2.85
1255 1328 3.482786 GATCGTGAAGAAATGCACACAC 58.517 45.455 0.00 0.00 34.78 3.82
1272 1345 2.094390 CACACTTTGAATGGCTGGATGG 60.094 50.000 0.00 0.00 0.00 3.51
1381 1454 0.742281 CTCTGACAGTTGGGGATGCG 60.742 60.000 1.59 0.00 0.00 4.73
1542 1616 6.183360 TGGTCATCACTCGTTAGAGATGTTAG 60.183 42.308 11.03 0.00 45.65 2.34
1613 1696 6.380095 TCTACGGTTTGCTTAAATTTGTGT 57.620 33.333 0.00 0.00 0.00 3.72
1745 1884 5.642063 AGTTTCTTCAGTTTCGTCAGACAAA 59.358 36.000 0.41 0.00 0.00 2.83
1761 1904 3.377172 AGACAAAACCGACCACAGAAAAG 59.623 43.478 0.00 0.00 0.00 2.27
1788 1933 3.431415 AGTTCTAGGGCCCAAATTGAAC 58.569 45.455 27.56 25.70 34.39 3.18
1936 2132 0.883833 GTTGGACTTGCCCATGTCAG 59.116 55.000 13.93 0.00 37.26 3.51
2051 2264 9.979270 TGTTTTTGTTGCAATAAAAATAGTGTG 57.021 25.926 34.46 0.00 39.81 3.82
2158 4323 0.907704 AGTCCGGTGGCACCATTAGA 60.908 55.000 34.11 21.67 38.47 2.10
2244 4493 2.459934 TCACGTAGCAAGCATACATCG 58.540 47.619 0.00 0.00 0.00 3.84
2334 4593 6.090763 GCATAGGCCACAAACTATTCAAAAAC 59.909 38.462 5.01 0.00 0.00 2.43
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
196 203 8.338072 TCATATGGTAAACGTGTTTTAATGGT 57.662 30.769 2.13 0.00 31.22 3.55
201 208 9.627395 CCATTTTCATATGGTAAACGTGTTTTA 57.373 29.630 2.13 0.00 40.20 1.52
318 328 0.930726 CTGAGGAGAGGAGGTAGGGT 59.069 60.000 0.00 0.00 0.00 4.34
537 554 9.977762 GGAAAAATACTAAACTTGGTATACGTG 57.022 33.333 0.00 0.00 34.32 4.49
756 780 4.323569 TCTAGAAGACCACATCTGAGGT 57.676 45.455 0.00 0.00 41.74 3.85
858 882 1.298859 GCCAACAAGTCTCGCGGATT 61.299 55.000 6.13 0.00 0.00 3.01
877 901 2.614987 CCAGAAGAAAGAGGAGGCACAG 60.615 54.545 0.00 0.00 0.00 3.66
928 993 3.099141 AGAAGAAGAAGCAGAGGAGGAG 58.901 50.000 0.00 0.00 0.00 3.69
929 994 3.096092 GAGAAGAAGAAGCAGAGGAGGA 58.904 50.000 0.00 0.00 0.00 3.71
930 995 2.168313 GGAGAAGAAGAAGCAGAGGAGG 59.832 54.545 0.00 0.00 0.00 4.30
1181 1249 8.642020 CCAGATCGAAAAAGAATTAAAAGCAAG 58.358 33.333 0.00 0.00 0.00 4.01
1255 1328 1.481871 AGCCATCCAGCCATTCAAAG 58.518 50.000 0.00 0.00 0.00 2.77
1272 1345 4.033587 TGAATTGAATCCGCTTAACGTAGC 59.966 41.667 0.00 0.00 41.42 3.58
1381 1454 5.388599 TCTTTATTTCCCCCTTCAGATCC 57.611 43.478 0.00 0.00 0.00 3.36
1475 1548 7.582667 AGAGCAACTACACAAAAATAAAGGT 57.417 32.000 0.00 0.00 0.00 3.50
1542 1616 2.069273 GAGCACATGACACCACACTAC 58.931 52.381 0.00 0.00 0.00 2.73
1745 1884 1.937899 CGTTCTTTTCTGTGGTCGGTT 59.062 47.619 0.00 0.00 0.00 4.44
1761 1904 1.188863 TGGGCCCTAGAACTACGTTC 58.811 55.000 25.70 0.00 42.25 3.95
1788 1933 1.077429 GGCCCAACCAGAGCTTAGG 60.077 63.158 0.00 4.01 38.86 2.69
2158 4323 4.745351 TGCTCTCTAGATGGATATGGTGT 58.255 43.478 0.00 0.00 0.00 4.16
2202 4450 6.920758 GTGAGATATCGGTAGATGAATATGGC 59.079 42.308 0.00 0.00 37.70 4.40
2209 4458 4.630505 GCTACGTGAGATATCGGTAGATGA 59.369 45.833 20.56 0.00 37.70 2.92
2244 4493 8.713271 GCTATGGTTGCTACTTTCTATGTTATC 58.287 37.037 0.00 0.00 0.00 1.75
2410 4682 4.877378 AAATGAGCCATGTTGATGTTGT 57.123 36.364 0.00 0.00 0.00 3.32
2439 4711 8.244113 AGTTGAAGTGTCAAAAAGGAAACTAAG 58.756 33.333 0.00 0.00 45.29 2.18


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.