Multiple sequence alignment - TraesCS4D01G171600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G171600 chr4D 100.000 2276 0 0 1 2276 298273073 298275348 0 4204
1 TraesCS4D01G171600 chr4D 96.814 973 31 0 1304 2276 424455790 424456762 0 1626
2 TraesCS4D01G171600 chr7D 98.008 1305 26 0 1 1305 544560454 544559150 0 2266
3 TraesCS4D01G171600 chr7D 97.318 1305 30 1 1 1305 599239745 599238446 0 2211
4 TraesCS4D01G171600 chr7D 96.817 974 29 2 1304 2276 332344999 332344027 0 1626
5 TraesCS4D01G171600 chr3D 97.546 1304 32 0 1 1304 31890960 31889657 0 2231
6 TraesCS4D01G171600 chr3D 96.917 973 30 0 1304 2276 374107475 374106503 0 1631
7 TraesCS4D01G171600 chr7B 92.945 1304 92 0 1 1304 706500288 706501591 0 1899
8 TraesCS4D01G171600 chr1A 92.496 1306 98 0 1 1306 65652204 65650899 0 1869
9 TraesCS4D01G171600 chr6B 92.331 1304 100 0 1 1304 173438468 173437165 0 1855
10 TraesCS4D01G171600 chr4B 94.021 1221 71 1 1 1221 605895610 605894392 0 1849
11 TraesCS4D01G171600 chr7A 92.107 1305 102 1 1 1305 79128437 79127134 0 1838
12 TraesCS4D01G171600 chr2B 94.177 1185 68 1 1 1185 683266695 683267878 0 1805
13 TraesCS4D01G171600 chr1D 97.225 973 27 0 1304 2276 314646563 314645591 0 1648
14 TraesCS4D01G171600 chr1D 96.814 973 31 0 1304 2276 288852687 288853659 0 1626
15 TraesCS4D01G171600 chr6D 97.122 973 27 1 1304 2276 358193493 358192522 0 1640
16 TraesCS4D01G171600 chr6D 96.917 973 30 0 1304 2276 79434731 79435703 0 1631
17 TraesCS4D01G171600 chr6D 96.814 973 31 0 1304 2276 380293311 380292339 0 1626
18 TraesCS4D01G171600 chr5D 96.917 973 30 0 1304 2276 340769059 340768087 0 1631


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G171600 chr4D 298273073 298275348 2275 False 4204 4204 100.000 1 2276 1 chr4D.!!$F1 2275
1 TraesCS4D01G171600 chr4D 424455790 424456762 972 False 1626 1626 96.814 1304 2276 1 chr4D.!!$F2 972
2 TraesCS4D01G171600 chr7D 544559150 544560454 1304 True 2266 2266 98.008 1 1305 1 chr7D.!!$R2 1304
3 TraesCS4D01G171600 chr7D 599238446 599239745 1299 True 2211 2211 97.318 1 1305 1 chr7D.!!$R3 1304
4 TraesCS4D01G171600 chr7D 332344027 332344999 972 True 1626 1626 96.817 1304 2276 1 chr7D.!!$R1 972
5 TraesCS4D01G171600 chr3D 31889657 31890960 1303 True 2231 2231 97.546 1 1304 1 chr3D.!!$R1 1303
6 TraesCS4D01G171600 chr3D 374106503 374107475 972 True 1631 1631 96.917 1304 2276 1 chr3D.!!$R2 972
7 TraesCS4D01G171600 chr7B 706500288 706501591 1303 False 1899 1899 92.945 1 1304 1 chr7B.!!$F1 1303
8 TraesCS4D01G171600 chr1A 65650899 65652204 1305 True 1869 1869 92.496 1 1306 1 chr1A.!!$R1 1305
9 TraesCS4D01G171600 chr6B 173437165 173438468 1303 True 1855 1855 92.331 1 1304 1 chr6B.!!$R1 1303
10 TraesCS4D01G171600 chr4B 605894392 605895610 1218 True 1849 1849 94.021 1 1221 1 chr4B.!!$R1 1220
11 TraesCS4D01G171600 chr7A 79127134 79128437 1303 True 1838 1838 92.107 1 1305 1 chr7A.!!$R1 1304
12 TraesCS4D01G171600 chr2B 683266695 683267878 1183 False 1805 1805 94.177 1 1185 1 chr2B.!!$F1 1184
13 TraesCS4D01G171600 chr1D 314645591 314646563 972 True 1648 1648 97.225 1304 2276 1 chr1D.!!$R1 972
14 TraesCS4D01G171600 chr1D 288852687 288853659 972 False 1626 1626 96.814 1304 2276 1 chr1D.!!$F1 972
15 TraesCS4D01G171600 chr6D 358192522 358193493 971 True 1640 1640 97.122 1304 2276 1 chr6D.!!$R1 972
16 TraesCS4D01G171600 chr6D 79434731 79435703 972 False 1631 1631 96.917 1304 2276 1 chr6D.!!$F1 972
17 TraesCS4D01G171600 chr6D 380292339 380293311 972 True 1626 1626 96.814 1304 2276 1 chr6D.!!$R2 972
18 TraesCS4D01G171600 chr5D 340768087 340769059 972 True 1631 1631 96.917 1304 2276 1 chr5D.!!$R1 972

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
413 414 1.538204 GGACGAGTGCACTCTCAAACA 60.538 52.381 36.78 0.0 40.75 2.83 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1922 1924 0.321653 GACGGTGCTTTGGAGATGGT 60.322 55.0 0.0 0.0 0.0 3.55 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
232 233 4.271687 CATTTACTCTGTTAAATCGGCGC 58.728 43.478 0.00 0.00 0.00 6.53
280 281 2.324541 GACATGCTCTAGATGAGGGGT 58.675 52.381 0.00 0.00 42.87 4.95
296 297 3.942351 GGTAGGTTACCGGCACTTT 57.058 52.632 0.00 0.00 39.39 2.66
413 414 1.538204 GGACGAGTGCACTCTCAAACA 60.538 52.381 36.78 0.00 40.75 2.83
595 596 8.253113 GGTCCAAAGACATTTTATGTGATCAAT 58.747 33.333 0.00 0.00 45.03 2.57
852 853 2.108514 CGATGATGGCAACGCAGGT 61.109 57.895 0.00 0.00 42.51 4.00
979 980 6.461231 GGAAGGAGTATTACTCGCAACACTAT 60.461 42.308 15.81 1.03 45.96 2.12
1330 1331 8.254508 ACTTAGCTTTCTCTAGGAACACATTAG 58.745 37.037 0.00 0.00 33.13 1.73
1351 1352 3.569701 AGAATTCAACGGAACAACAGCAT 59.430 39.130 8.44 0.00 35.46 3.79
1479 1480 7.959658 AGATAGACATCCCTCTAATCATCTG 57.040 40.000 0.00 0.00 0.00 2.90
1546 1547 4.989168 ACGTGAGATGGAGTAGTTTTCAAC 59.011 41.667 0.00 0.00 0.00 3.18
1828 1829 7.220030 AGAGATCATCTTATAATGCAACCGTT 58.780 34.615 0.00 0.00 32.99 4.44
1914 1916 1.064240 TGGCCATCATCATCTTGTGCT 60.064 47.619 0.00 0.00 0.00 4.40
1922 1924 6.405397 CCATCATCATCTTGTGCTTTTGATCA 60.405 38.462 0.00 0.00 0.00 2.92
2181 2183 4.313282 AGCATCATGTCTTGACCATATCG 58.687 43.478 0.00 0.00 37.11 2.92
2182 2184 4.039609 AGCATCATGTCTTGACCATATCGA 59.960 41.667 0.00 0.00 37.11 3.59
2258 2260 1.818959 TTTACGTGGCTGCTACGGGT 61.819 55.000 35.30 21.67 45.24 5.28
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
232 233 1.913317 TGATTCACGAGAGCACGATG 58.087 50.000 5.12 0.00 37.03 3.84
280 281 2.234414 CCACTAAAGTGCCGGTAACCTA 59.766 50.000 1.90 0.00 44.34 3.08
296 297 4.071423 CCACACATGTTGTTGATCCACTA 58.929 43.478 0.00 0.00 35.67 2.74
413 414 2.048444 AATCTGCTTCATGTGGCGAT 57.952 45.000 0.00 3.98 0.00 4.58
595 596 3.560068 GCTCGTTCCTTCTCAGAAAAACA 59.440 43.478 11.16 1.33 0.00 2.83
1330 1331 3.347958 TGCTGTTGTTCCGTTGAATTC 57.652 42.857 0.00 0.00 31.98 2.17
1351 1352 3.521531 TGTTGTTGTAGATAGATGGCCCA 59.478 43.478 0.00 0.00 0.00 5.36
1822 1823 7.266922 TCTTATTTTGCTTAGTTCAACGGTT 57.733 32.000 0.00 0.00 0.00 4.44
1914 1916 4.022068 GTGCTTTGGAGATGGTGATCAAAA 60.022 41.667 0.00 0.00 0.00 2.44
1922 1924 0.321653 GACGGTGCTTTGGAGATGGT 60.322 55.000 0.00 0.00 0.00 3.55
2181 2183 0.889994 TGCAGGGCATGTTGTGATTC 59.110 50.000 0.00 0.00 31.71 2.52
2182 2184 1.340088 TTGCAGGGCATGTTGTGATT 58.660 45.000 0.00 0.00 38.76 2.57


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.