Multiple sequence alignment - TraesCS4D01G166100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G166100 chr4D 100.000 2513 0 0 1 2513 280140039 280142551 0.000000e+00 4641
1 TraesCS4D01G166100 chr4D 97.418 2517 57 7 1 2513 329901383 329903895 0.000000e+00 4281
2 TraesCS4D01G166100 chr4D 96.902 2518 69 8 1 2513 277288214 277290727 0.000000e+00 4209
3 TraesCS4D01G166100 chr4D 97.045 2369 56 11 1 2366 403260742 403263099 0.000000e+00 3975
4 TraesCS4D01G166100 chr7D 97.296 2515 56 8 1 2513 404002742 404005246 0.000000e+00 4257
5 TraesCS4D01G166100 chr1D 97.220 2518 56 10 1 2513 466981854 466979346 0.000000e+00 4250
6 TraesCS4D01G166100 chr1D 97.433 2376 54 7 1 2372 39392149 39389777 0.000000e+00 4043
7 TraesCS4D01G166100 chr1D 96.795 156 4 1 2358 2513 77982410 77982564 2.480000e-65 259
8 TraesCS4D01G166100 chr5D 97.145 2487 63 6 1 2484 215554603 215552122 0.000000e+00 4193
9 TraesCS4D01G166100 chr3D 95.787 2516 73 13 1 2513 42216038 42213553 0.000000e+00 4028
10 TraesCS4D01G166100 chr3D 96.795 156 4 1 2358 2513 533783222 533783376 2.480000e-65 259
11 TraesCS4D01G166100 chr2D 97.177 2373 63 4 1 2372 118670696 118668327 0.000000e+00 4008
12 TraesCS4D01G166100 chr4A 96.795 156 5 0 2358 2513 246820586 246820431 6.890000e-66 261
13 TraesCS4D01G166100 chr6D 96.795 156 4 1 2358 2513 451146546 451146700 2.480000e-65 259


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G166100 chr4D 280140039 280142551 2512 False 4641 4641 100.000 1 2513 1 chr4D.!!$F2 2512
1 TraesCS4D01G166100 chr4D 329901383 329903895 2512 False 4281 4281 97.418 1 2513 1 chr4D.!!$F3 2512
2 TraesCS4D01G166100 chr4D 277288214 277290727 2513 False 4209 4209 96.902 1 2513 1 chr4D.!!$F1 2512
3 TraesCS4D01G166100 chr4D 403260742 403263099 2357 False 3975 3975 97.045 1 2366 1 chr4D.!!$F4 2365
4 TraesCS4D01G166100 chr7D 404002742 404005246 2504 False 4257 4257 97.296 1 2513 1 chr7D.!!$F1 2512
5 TraesCS4D01G166100 chr1D 466979346 466981854 2508 True 4250 4250 97.220 1 2513 1 chr1D.!!$R2 2512
6 TraesCS4D01G166100 chr1D 39389777 39392149 2372 True 4043 4043 97.433 1 2372 1 chr1D.!!$R1 2371
7 TraesCS4D01G166100 chr5D 215552122 215554603 2481 True 4193 4193 97.145 1 2484 1 chr5D.!!$R1 2483
8 TraesCS4D01G166100 chr3D 42213553 42216038 2485 True 4028 4028 95.787 1 2513 1 chr3D.!!$R1 2512
9 TraesCS4D01G166100 chr2D 118668327 118670696 2369 True 4008 4008 97.177 1 2372 1 chr2D.!!$R1 2371

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
523 536 0.328258 ATGCTCCAAACCCTAGCGTT 59.672 50.0 0.0 0.0 39.14 4.84 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1871 1894 4.601406 TTATCCTTTGTGGGCCTATTGT 57.399 40.909 4.53 0.0 36.2 2.71 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
48 49 9.618890 CAGATCCTTCTTATTCACTCCAAAATA 57.381 33.333 0.00 0.00 0.00 1.40
236 244 9.685276 TTTTCTCATAACCTTGTCACATATGAT 57.315 29.630 10.38 0.00 37.14 2.45
466 479 4.502950 GGCCATTTGAAATCTGGTCAAACA 60.503 41.667 0.00 0.00 45.19 2.83
467 480 5.055812 GCCATTTGAAATCTGGTCAAACAA 58.944 37.500 1.94 0.00 45.19 2.83
523 536 0.328258 ATGCTCCAAACCCTAGCGTT 59.672 50.000 0.00 0.00 39.14 4.84
772 785 6.464222 CAAATCGTCAATATAGCTTCCCCTA 58.536 40.000 0.00 0.00 0.00 3.53
857 870 3.196685 CCCCATCTTCTCGTTCTTCTTCT 59.803 47.826 0.00 0.00 0.00 2.85
937 950 3.156288 TCCTCTGTTTCTTCCTCTCGA 57.844 47.619 0.00 0.00 0.00 4.04
1030 1043 1.228769 ACTGACTGCCCACGGACTA 60.229 57.895 0.00 0.00 0.00 2.59
1304 1318 1.227102 CGAGGGGGAATGCAATCCA 59.773 57.895 22.22 0.00 41.55 3.41
1338 1352 2.046988 CATGACAGTGCCGCTCCA 60.047 61.111 0.00 0.00 0.00 3.86
1410 1424 6.881065 TGAAGACGGAATTGAAGAAGATGAAT 59.119 34.615 0.00 0.00 0.00 2.57
1871 1894 2.357154 GGGCCCAAAGAGAATCAAGCTA 60.357 50.000 19.95 0.00 37.82 3.32
1907 1930 4.821532 AGGATAAATGAGGCCCAGAAAT 57.178 40.909 0.00 0.00 0.00 2.17
2044 2073 3.053170 GGCTTTCCTTTATGGGTCCCTTA 60.053 47.826 10.00 4.21 36.20 2.69
2133 2163 3.057586 TGGAAAAAGAGGTCCAACCCTA 58.942 45.455 0.00 0.00 41.02 3.53
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
14 15 8.261522 AGTGAATAAGAAGGATCTGAACTTACC 58.738 37.037 0.00 0.00 35.59 2.85
146 151 4.394300 GCTTCACACAAATGAGCTATCACT 59.606 41.667 0.00 0.00 38.57 3.41
236 244 1.462616 AATTCTTGCGCACATAGCCA 58.537 45.000 11.12 0.00 41.38 4.75
466 479 3.118519 AGCGAGTCAACGGGGTTATTATT 60.119 43.478 0.00 0.00 0.00 1.40
467 480 2.433239 AGCGAGTCAACGGGGTTATTAT 59.567 45.455 0.00 0.00 0.00 1.28
679 692 0.954938 CATGTGGTGGTCATGTGCGA 60.955 55.000 0.00 0.00 38.17 5.10
772 785 3.011144 TCTGTCAGATGGAGAAGAGGAGT 59.989 47.826 0.00 0.00 0.00 3.85
857 870 3.685139 AACAGAGGAATTGCTCGAGAA 57.315 42.857 18.75 1.15 0.00 2.87
975 988 1.983119 CTGGACCATACACCGGCCAT 61.983 60.000 0.00 0.00 31.90 4.40
1118 1131 4.434520 CGAGGAAAACTCAGATCTAACCC 58.565 47.826 0.00 0.00 46.98 4.11
1170 1183 8.906867 CATGTAACCTAAATCCAAATCTGACAT 58.093 33.333 0.00 0.00 0.00 3.06
1304 1318 0.620556 ATGGGGCAGATTGAACTCGT 59.379 50.000 0.00 0.00 0.00 4.18
1410 1424 5.308014 TCAATCAGCTGCTTGAAGTTCTTA 58.692 37.500 26.31 5.41 28.56 2.10
1550 1565 5.702865 TGCATTTGAGATAAACAGACTTGC 58.297 37.500 0.00 0.00 0.00 4.01
1871 1894 4.601406 TTATCCTTTGTGGGCCTATTGT 57.399 40.909 4.53 0.00 36.20 2.71


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.