Multiple sequence alignment - TraesCS4D01G146200

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G146200 chr4D 100.000 2315 0 0 1 2315 134998796 134996482 0 4276
1 TraesCS4D01G146200 chr5A 98.320 2321 33 2 1 2315 300072978 300075298 0 4065
2 TraesCS4D01G146200 chr5A 98.101 2317 42 1 1 2315 16602920 16600604 0 4034
3 TraesCS4D01G146200 chrUn 98.277 2321 34 2 1 2315 189392538 189394858 0 4060
4 TraesCS4D01G146200 chr2A 98.234 2321 35 2 1 2315 618279957 618277637 0 4054
5 TraesCS4D01G146200 chr6A 98.146 2319 39 2 1 2315 289128631 289130949 0 4041
6 TraesCS4D01G146200 chr7D 98.104 2321 38 2 1 2315 626698491 626696171 0 4037
7 TraesCS4D01G146200 chr7D 97.974 2320 42 2 1 2315 203556346 203554027 0 4019
8 TraesCS4D01G146200 chr7B 98.104 2321 38 3 1 2315 743086198 743088518 0 4037
9 TraesCS4D01G146200 chr7A 97.935 2325 38 3 1 2315 4959837 4962161 0 4019


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G146200 chr4D 134996482 134998796 2314 True 4276 4276 100.000 1 2315 1 chr4D.!!$R1 2314
1 TraesCS4D01G146200 chr5A 300072978 300075298 2320 False 4065 4065 98.320 1 2315 1 chr5A.!!$F1 2314
2 TraesCS4D01G146200 chr5A 16600604 16602920 2316 True 4034 4034 98.101 1 2315 1 chr5A.!!$R1 2314
3 TraesCS4D01G146200 chrUn 189392538 189394858 2320 False 4060 4060 98.277 1 2315 1 chrUn.!!$F1 2314
4 TraesCS4D01G146200 chr2A 618277637 618279957 2320 True 4054 4054 98.234 1 2315 1 chr2A.!!$R1 2314
5 TraesCS4D01G146200 chr6A 289128631 289130949 2318 False 4041 4041 98.146 1 2315 1 chr6A.!!$F1 2314
6 TraesCS4D01G146200 chr7D 626696171 626698491 2320 True 4037 4037 98.104 1 2315 1 chr7D.!!$R2 2314
7 TraesCS4D01G146200 chr7D 203554027 203556346 2319 True 4019 4019 97.974 1 2315 1 chr7D.!!$R1 2314
8 TraesCS4D01G146200 chr7B 743086198 743088518 2320 False 4037 4037 98.104 1 2315 1 chr7B.!!$F1 2314
9 TraesCS4D01G146200 chr7A 4959837 4962161 2324 False 4019 4019 97.935 1 2315 1 chr7A.!!$F1 2314

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
941 946 0.40675 TTCACAGTCCCCCTACGAGA 59.593 55.0 0.0 0.0 0.0 4.04 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2049 2066 1.028868 GCAAGAAGCTTCTCGGCCAT 61.029 55.0 29.24 14.09 41.15 4.4 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
25 26 1.354101 TAAAGGGCTTCGACAAGGGA 58.646 50.000 0.00 0.0 0.00 4.20
173 174 0.473326 GCCCAGCATCTCTCCTGAAT 59.527 55.000 0.00 0.0 0.00 2.57
223 224 2.186125 CCCGAGGCGAGGGTAAAC 59.814 66.667 11.48 0.0 43.89 2.01
548 552 4.633175 TCGTAACTTCAAGCACAACCATA 58.367 39.130 0.00 0.0 0.00 2.74
589 593 2.417379 CGATCGTCTGTGATCCAAACCT 60.417 50.000 7.03 0.0 41.39 3.50
866 870 6.368805 AGAATTCATATCAGAACCCTTTCCC 58.631 40.000 8.44 0.0 31.28 3.97
913 918 4.498241 TCGACTCACATTTTGATCTCCTG 58.502 43.478 0.00 0.0 32.17 3.86
941 946 0.406750 TTCACAGTCCCCCTACGAGA 59.593 55.000 0.00 0.0 0.00 4.04
951 956 1.610554 CCCTACGAGAAGCCCGGAAA 61.611 60.000 0.73 0.0 0.00 3.13
1022 1027 7.412563 CAATATGTTGATTGTACCGAACGAAGT 60.413 37.037 0.00 0.0 39.49 3.01
1079 1084 3.196613 GGAAGTCACACGTCCTGTC 57.803 57.895 1.76 0.0 42.40 3.51
1204 1216 3.369892 GCGGATCTATCTAATGGCATGGT 60.370 47.826 0.00 0.0 0.00 3.55
1233 1245 4.679197 GTCAGATGTGATCTATTCTCGTGC 59.321 45.833 0.00 0.0 37.58 5.34
1324 1336 4.381825 GCATTGTGGAATAGTGGCATTTCA 60.382 41.667 0.00 0.0 0.00 2.69
1369 1381 3.597728 GGGTTGCCGCAAAACCGA 61.598 61.111 7.54 0.0 46.77 4.69
1682 1699 6.070309 GCTATCTATCCAGATCAGGGTTGAAT 60.070 42.308 5.70 0.0 40.81 2.57
1735 1752 5.913137 AATCCATTGCGATTAGAAACCAA 57.087 34.783 0.00 0.0 30.59 3.67
1844 1861 2.608268 CAAATCATTTGCCGACATGCA 58.392 42.857 0.00 0.0 40.07 3.96
2014 2031 2.219674 GCTGACTGACTGTTTGAACGAG 59.780 50.000 0.00 0.0 0.00 4.18
2049 2066 6.664714 AGTAGCTAATCAAGTCAGAGTAGGA 58.335 40.000 0.00 0.0 36.86 2.94
2108 2125 1.827969 GCACAGACTCTACTCACCCAT 59.172 52.381 0.00 0.0 0.00 4.00
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
25 26 7.706179 TCTTTTTGCTCAAAGAACGAATCAAAT 59.294 29.630 8.05 0.00 39.37 2.32
173 174 1.709578 AGAGTCTGCAGAAGGTGTCA 58.290 50.000 20.19 0.00 0.00 3.58
223 224 3.187842 CCTGACCGATATGAATGCACATG 59.812 47.826 0.00 0.00 0.00 3.21
292 293 8.827677 GCTTCCACTAATGTCGTATAAGAATTT 58.172 33.333 0.00 0.00 0.00 1.82
548 552 5.102953 TCGGAGATTTTGGATTGAGATGT 57.897 39.130 0.00 0.00 0.00 3.06
850 854 1.580059 AGCGGGAAAGGGTTCTGATA 58.420 50.000 0.00 0.00 33.92 2.15
866 870 1.131693 GATGGGTAAAAACGGGAAGCG 59.868 52.381 0.00 0.00 0.00 4.68
913 918 1.081840 GGACTGTGAAAGCAAGCGC 60.082 57.895 0.00 0.00 38.99 5.92
941 946 1.203001 TCCTTCATTGTTTCCGGGCTT 60.203 47.619 0.00 0.00 0.00 4.35
1022 1027 4.893424 GGCTTTCGTGATAAGGCAAATA 57.107 40.909 0.00 0.00 44.81 1.40
1204 1216 5.129980 AGAATAGATCACATCTGACAGCCAA 59.870 40.000 0.00 0.00 40.51 4.52
1233 1245 3.126000 GGAGAAGAAAGAAAGCGATGTGG 59.874 47.826 0.00 0.00 0.00 4.17
1369 1381 3.896317 GAGACCGCTCTGAGTTTGT 57.104 52.632 6.53 1.30 38.16 2.83
1682 1699 1.614996 TGGCTTTTCCATTCGCTTCA 58.385 45.000 0.00 0.00 40.72 3.02
1735 1752 2.216148 GCCCTGGCTGTAGAGTCAT 58.784 57.895 0.00 0.00 31.88 3.06
1844 1861 6.441924 TCATCCCATTAAAGAGAAGTGAGTCT 59.558 38.462 0.00 0.00 0.00 3.24
2014 2031 8.168790 ACTTGATTAGCTACTAGTAACTAGGC 57.831 38.462 11.78 7.79 38.30 3.93
2049 2066 1.028868 GCAAGAAGCTTCTCGGCCAT 61.029 55.000 29.24 14.09 41.15 4.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.