Multiple sequence alignment - TraesCS4D01G146100

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G146100 chr4D 100.000 2722 0 0 1 2722 134997305 134994584 0 5027
1 TraesCS4D01G146100 chr4D 98.275 2725 42 4 1 2722 123414378 123417100 0 4767
2 TraesCS4D01G146100 chrUn 98.497 2727 36 5 1 2722 189394035 189396761 0 4804
3 TraesCS4D01G146100 chr5B 98.385 2725 41 3 1 2722 679660393 679663117 0 4785
4 TraesCS4D01G146100 chr7B 98.349 2725 42 3 1 2722 743087695 743090419 0 4780
5 TraesCS4D01G146100 chr7D 98.313 2726 41 5 2 2722 203554849 203552124 0 4774
6 TraesCS4D01G146100 chr5A 98.239 2725 45 3 1 2722 16601427 16598703 0 4763
7 TraesCS4D01G146100 chr5A 98.091 2724 48 4 1 2720 300074475 300077198 0 4739
8 TraesCS4D01G146100 chr6A 98.128 2725 48 3 1 2722 289130126 289132850 0 4747
9 TraesCS4D01G146100 chr2A 97.872 2725 53 5 1 2722 735194150 735196872 0 4706


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G146100 chr4D 134994584 134997305 2721 True 5027 5027 100.000 1 2722 1 chr4D.!!$R1 2721
1 TraesCS4D01G146100 chr4D 123414378 123417100 2722 False 4767 4767 98.275 1 2722 1 chr4D.!!$F1 2721
2 TraesCS4D01G146100 chrUn 189394035 189396761 2726 False 4804 4804 98.497 1 2722 1 chrUn.!!$F1 2721
3 TraesCS4D01G146100 chr5B 679660393 679663117 2724 False 4785 4785 98.385 1 2722 1 chr5B.!!$F1 2721
4 TraesCS4D01G146100 chr7B 743087695 743090419 2724 False 4780 4780 98.349 1 2722 1 chr7B.!!$F1 2721
5 TraesCS4D01G146100 chr7D 203552124 203554849 2725 True 4774 4774 98.313 2 2722 1 chr7D.!!$R1 2720
6 TraesCS4D01G146100 chr5A 16598703 16601427 2724 True 4763 4763 98.239 1 2722 1 chr5A.!!$R1 2721
7 TraesCS4D01G146100 chr5A 300074475 300077198 2723 False 4739 4739 98.091 1 2720 1 chr5A.!!$F1 2719
8 TraesCS4D01G146100 chr6A 289130126 289132850 2724 False 4747 4747 98.128 1 2722 1 chr6A.!!$F1 2721
9 TraesCS4D01G146100 chr2A 735194150 735196872 2722 False 4706 4706 97.872 1 2722 1 chr2A.!!$F1 2721

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
925 926 1.097232 TTCCATGGAAAGCATGCGAG 58.903 50.0 25.13 0.0 0.0 5.03 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2445 2453 0.465097 GCCACATGCATGAGTAGGCT 60.465 55.0 32.75 5.74 40.77 4.58 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
191 192 6.070309 GCTATCTATCCAGATCAGGGTTGAAT 60.070 42.308 5.70 0.00 40.81 2.57
244 245 5.913137 AATCCATTGCGATTAGAAACCAA 57.087 34.783 0.00 0.00 30.59 3.67
353 354 2.608268 CAAATCATTTGCCGACATGCA 58.392 42.857 0.00 0.00 40.07 3.96
523 524 2.219674 GCTGACTGACTGTTTGAACGAG 59.780 50.000 0.00 0.00 0.00 4.18
558 559 6.664714 AGTAGCTAATCAAGTCAGAGTAGGA 58.335 40.000 0.00 0.00 36.86 2.94
617 618 1.827969 GCACAGACTCTACTCACCCAT 59.172 52.381 0.00 0.00 0.00 4.00
925 926 1.097232 TTCCATGGAAAGCATGCGAG 58.903 50.000 25.13 0.00 0.00 5.03
1098 1101 4.278419 GGTTGTTCTTAACAGTGATGGCTT 59.722 41.667 0.00 0.00 43.27 4.35
1114 1117 7.231317 AGTGATGGCTTTTCATTTAAGTCTTCA 59.769 33.333 0.00 0.00 38.36 3.02
1627 1631 3.068307 CCCTTCTCTACCCGTATCTTGTG 59.932 52.174 0.00 0.00 0.00 3.33
1644 1648 0.375803 GTGCGTTCTGGAAACACGTT 59.624 50.000 0.00 0.00 35.60 3.99
1685 1689 3.069729 CCGAATCTCCCTTAACGGAAGAT 59.930 47.826 0.00 0.00 42.40 2.40
1768 1772 1.486310 ACTCGCTAAAGCATCCATGGA 59.514 47.619 18.88 18.88 42.21 3.41
1825 1830 5.452636 GCAAAATGGGTCAAAAGTAGGTTCA 60.453 40.000 0.00 0.00 0.00 3.18
1921 1926 7.807907 GCTTTTGGATTCTTATCGAAAGTGAAA 59.192 33.333 0.00 0.00 38.93 2.69
1922 1927 9.677567 CTTTTGGATTCTTATCGAAAGTGAAAA 57.322 29.630 0.00 0.00 38.93 2.29
2037 2042 5.538433 TGGGAACAAAAAGGATTCAACTAGG 59.462 40.000 0.00 0.00 37.44 3.02
2153 2159 3.066203 GGCGTATCACAGGGGTATTTTTG 59.934 47.826 0.00 0.00 0.00 2.44
2290 2298 4.305769 GAGGAGATGGATCGAATTCAGTG 58.694 47.826 6.22 0.00 0.00 3.66
2420 2428 3.464720 TTTCAAATATGGGACCTGCCA 57.535 42.857 0.00 0.00 38.95 4.92
2476 2484 1.743772 GCATGTGGCCAAGTACTCGAT 60.744 52.381 7.24 0.00 36.11 3.59
2582 2590 5.336451 CGTTCGATATTGGATGGAGTATGGA 60.336 44.000 0.00 0.00 0.00 3.41
2703 2711 4.349342 AGACAGACCTTCATGAAGACCTTT 59.651 41.667 32.49 21.22 40.79 3.11
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
191 192 1.614996 TGGCTTTTCCATTCGCTTCA 58.385 45.000 0.00 0.00 40.72 3.02
244 245 2.216148 GCCCTGGCTGTAGAGTCAT 58.784 57.895 0.00 0.00 31.88 3.06
353 354 6.441924 TCATCCCATTAAAGAGAAGTGAGTCT 59.558 38.462 0.00 0.00 0.00 3.24
523 524 8.168790 ACTTGATTAGCTACTAGTAACTAGGC 57.831 38.462 11.78 7.79 38.30 3.93
558 559 1.028868 GCAAGAAGCTTCTCGGCCAT 61.029 55.000 29.24 14.09 41.15 4.40
814 815 5.941948 TCGGAAAAAGAAGGATTGACTTC 57.058 39.130 0.00 0.00 45.59 3.01
1098 1101 6.430000 GGTGCTACCTGAAGACTTAAATGAAA 59.570 38.462 0.00 0.00 34.73 2.69
1114 1117 1.834263 GAAGATCTGGTGGTGCTACCT 59.166 52.381 0.00 0.00 41.43 3.08
1210 1213 6.013206 TGGGAACAAGGAACTGTTTATAGCTA 60.013 38.462 0.00 0.00 40.86 3.32
1627 1631 2.106418 GAAAACGTGTTTCCAGAACGC 58.894 47.619 0.00 0.00 40.90 4.84
1644 1648 5.444744 TCGGGAAAAGATGGAATAGGAAA 57.555 39.130 0.00 0.00 0.00 3.13
1685 1689 6.207025 GTGGTATTCCTTCTCGAGCTTCTATA 59.793 42.308 7.81 0.23 34.23 1.31
1768 1772 0.611618 TGGGCGCTTTCACCATTCAT 60.612 50.000 7.64 0.00 0.00 2.57
2290 2298 9.533253 TTGAAGATCATCAAAGAAAGGAAAAAC 57.467 29.630 10.81 0.00 36.42 2.43
2445 2453 0.465097 GCCACATGCATGAGTAGGCT 60.465 55.000 32.75 5.74 40.77 4.58
2476 2484 1.676678 CCCTTCGCTCCGAGGATTGA 61.677 60.000 0.00 0.00 37.14 2.57
2517 2525 2.094894 GTGATGCTGACCTCAATGAACG 59.905 50.000 0.00 0.00 0.00 3.95


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.