Multiple sequence alignment - TraesCS4D01G146000

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G146000 chr4D 100.000 2243 0 0 1 2243 134979423 134981665 0 4143
1 TraesCS4D01G146000 chr4D 97.326 2244 56 2 1 2243 123350121 123352361 0 3808
2 TraesCS4D01G146000 chr4D 95.854 2243 83 4 1 2243 240994775 240992543 0 3618
3 TraesCS4D01G146000 chr4D 97.258 1641 41 2 604 2243 123561662 123563299 0 2778
4 TraesCS4D01G146000 chr5D 96.790 2243 65 5 1 2243 301054400 301056635 0 3736
5 TraesCS4D01G146000 chr6D 96.078 2244 67 9 1 2243 370022517 370024740 0 3637
6 TraesCS4D01G146000 chr6D 96.546 1158 35 2 1086 2243 369972795 369971643 0 1912
7 TraesCS4D01G146000 chr1D 95.898 2243 71 4 1 2243 269426749 269424528 0 3613
8 TraesCS4D01G146000 chr6A 93.767 2246 101 12 1 2243 79195949 79198158 0 3336
9 TraesCS4D01G146000 chr7B 97.863 1310 28 0 1 1310 742948738 742947429 0 2265
10 TraesCS4D01G146000 chr7A 97.858 1307 28 0 1 1307 60084936 60086242 0 2259
11 TraesCS4D01G146000 chr7A 97.786 1310 29 0 1 1310 60168767 60167458 0 2259
12 TraesCS4D01G146000 chr7D 97.615 1216 25 2 1028 2243 382029169 382027958 0 2082


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G146000 chr4D 134979423 134981665 2242 False 4143 4143 100.000 1 2243 1 chr4D.!!$F3 2242
1 TraesCS4D01G146000 chr4D 123350121 123352361 2240 False 3808 3808 97.326 1 2243 1 chr4D.!!$F1 2242
2 TraesCS4D01G146000 chr4D 240992543 240994775 2232 True 3618 3618 95.854 1 2243 1 chr4D.!!$R1 2242
3 TraesCS4D01G146000 chr4D 123561662 123563299 1637 False 2778 2778 97.258 604 2243 1 chr4D.!!$F2 1639
4 TraesCS4D01G146000 chr5D 301054400 301056635 2235 False 3736 3736 96.790 1 2243 1 chr5D.!!$F1 2242
5 TraesCS4D01G146000 chr6D 370022517 370024740 2223 False 3637 3637 96.078 1 2243 1 chr6D.!!$F1 2242
6 TraesCS4D01G146000 chr6D 369971643 369972795 1152 True 1912 1912 96.546 1086 2243 1 chr6D.!!$R1 1157
7 TraesCS4D01G146000 chr1D 269424528 269426749 2221 True 3613 3613 95.898 1 2243 1 chr1D.!!$R1 2242
8 TraesCS4D01G146000 chr6A 79195949 79198158 2209 False 3336 3336 93.767 1 2243 1 chr6A.!!$F1 2242
9 TraesCS4D01G146000 chr7B 742947429 742948738 1309 True 2265 2265 97.863 1 1310 1 chr7B.!!$R1 1309
10 TraesCS4D01G146000 chr7A 60084936 60086242 1306 False 2259 2259 97.858 1 1307 1 chr7A.!!$F1 1306
11 TraesCS4D01G146000 chr7A 60167458 60168767 1309 True 2259 2259 97.786 1 1310 1 chr7A.!!$R1 1309
12 TraesCS4D01G146000 chr7D 382027958 382029169 1211 True 2082 2082 97.615 1028 2243 1 chr7D.!!$R1 1215

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
303 304 0.881796 GGCTTACAGAAGTGCCCAAC 59.118 55.0 0.0 0.0 39.49 3.77 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1704 1715 0.039618 GAAGGAGTTTCATGCCCCCA 59.96 55.0 0.0 0.0 35.78 4.96 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 4.448200 CCCCACCAATGTGATCTCCATTAT 60.448 45.833 9.80 1.77 45.76 1.28
174 175 7.333528 TCAGTTGAAAGCTATGAAACAAGTT 57.666 32.000 0.00 0.00 0.00 2.66
218 219 1.472480 GGCACAATATTGCGAAGTGGT 59.528 47.619 15.48 0.00 44.00 4.16
303 304 0.881796 GGCTTACAGAAGTGCCCAAC 59.118 55.000 0.00 0.00 39.49 3.77
404 405 4.207891 TGCCACTAGACAGAATTTCTCC 57.792 45.455 0.00 0.00 0.00 3.71
497 499 8.897872 TTAACTAACGAAAGAAAGATGGAACT 57.102 30.769 0.00 0.00 0.00 3.01
616 618 4.439253 ACTGAACCCCAATAGGCTATTC 57.561 45.455 16.70 6.57 0.00 1.75
746 748 3.579302 CCACCCAGCCCCACAAGA 61.579 66.667 0.00 0.00 0.00 3.02
835 837 9.499585 CACAGCTCATTTTCTTTAATATGTGAG 57.500 33.333 0.00 0.00 36.20 3.51
911 913 8.206189 CCAATATTTGAAAATTATGGAGGTGCT 58.794 33.333 11.34 0.00 36.11 4.40
1106 1113 3.756434 GGTTCTTTGATTCATTCCGTGGA 59.244 43.478 0.00 0.00 0.00 4.02
1223 1230 5.412594 CCTTTCTGATCTCATTCGTTTTCCA 59.587 40.000 0.00 0.00 0.00 3.53
1334 1342 8.040132 TCGATGATGGCCTTTTTATTGATTTTT 58.960 29.630 3.32 0.00 0.00 1.94
1486 1496 9.995003 GGTAAGACTTGATCTATCATCTGATTT 57.005 33.333 0.00 0.00 36.27 2.17
1502 1512 9.656040 TCATCTGATTTTGGTTTTTATCAATGG 57.344 29.630 0.00 0.00 0.00 3.16
1503 1513 8.885722 CATCTGATTTTGGTTTTTATCAATGGG 58.114 33.333 0.00 0.00 0.00 4.00
1661 1672 4.229096 CCACGTTGATTGAAGAAATGGTG 58.771 43.478 0.00 0.00 0.00 4.17
1881 1892 3.695060 TCCGTCAGTAGATTTCCACTCTC 59.305 47.826 0.00 0.00 0.00 3.20
1886 1897 4.026744 CAGTAGATTTCCACTCTCCTCCA 58.973 47.826 0.00 0.00 0.00 3.86
1970 1981 2.035632 ACCCTAGCTGAAATCCGAGAG 58.964 52.381 0.00 0.00 0.00 3.20
1997 2008 2.437359 GCTCCGCCAACAGCTGAT 60.437 61.111 23.35 5.41 40.39 2.90
2004 2015 0.394762 GCCAACAGCTGATGATCCCA 60.395 55.000 24.19 0.00 38.99 4.37
2105 2118 0.387239 CGCAAAAGCCTTTTCCCGAG 60.387 55.000 11.87 0.00 30.48 4.63
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
53 54 6.775142 TGTTTCCAAACAGATTTGTCCATCTA 59.225 34.615 0.55 0.0 43.45 1.98
174 175 2.920524 TCCAGTTTTGAACTACCGCAA 58.079 42.857 0.00 0.0 40.46 4.85
218 219 1.305219 CCCAAATTGAGCGAAGGCGA 61.305 55.000 0.00 0.0 46.35 5.54
303 304 4.082245 GGAAGTGGTTCATATTGTGGTTGG 60.082 45.833 0.00 0.0 33.93 3.77
435 436 9.243105 TCTAAGAAGGATTTTTGTAATTCAGGG 57.757 33.333 0.00 0.0 0.00 4.45
746 748 1.611556 GGTAGGGGGTCCGTCAACT 60.612 63.158 0.00 0.0 38.33 3.16
835 837 7.707893 ACATATTATCACAATTTGCAAGGCTTC 59.292 33.333 0.00 0.0 0.00 3.86
911 913 3.517296 TGATTCAAAGTACTTGGGCCA 57.483 42.857 9.34 0.0 35.56 5.36
1007 1014 3.316308 GGCACCTATTGATTTAGCACCTG 59.684 47.826 0.00 0.0 0.00 4.00
1063 1070 3.267483 CGAGGACGTTTCCAATACCAAT 58.733 45.455 0.00 0.0 45.72 3.16
1065 1072 1.066716 CCGAGGACGTTTCCAATACCA 60.067 52.381 0.00 0.0 45.72 3.25
1106 1113 2.062971 AGCCAATGATGGATTTCGCT 57.937 45.000 0.00 0.0 44.90 4.93
1162 1169 2.420022 ACAATGCAATAGCTTCGGTGAC 59.580 45.455 0.00 0.0 42.74 3.67
1223 1230 7.558161 TGATCTCATGACTTTTTATGCGATT 57.442 32.000 0.00 0.0 31.11 3.34
1334 1342 6.948309 TCCATTCATAGAGAGATCCAATCGTA 59.052 38.462 0.00 0.0 0.00 3.43
1629 1640 4.518249 TCAATCAACGTGGCACCATATAA 58.482 39.130 12.86 0.0 0.00 0.98
1704 1715 0.039618 GAAGGAGTTTCATGCCCCCA 59.960 55.000 0.00 0.0 35.78 4.96
1711 1722 1.068474 CGAACGCGAAGGAGTTTCAT 58.932 50.000 15.93 0.0 40.82 2.57
1881 1892 1.379642 GGATTTGCTTCGGCTGGAGG 61.380 60.000 2.14 0.0 42.37 4.30
1886 1897 1.106285 GGAATGGATTTGCTTCGGCT 58.894 50.000 0.00 0.0 42.37 5.52
1997 2008 4.473196 TCCTTAGCATTACTGTTGGGATCA 59.527 41.667 0.00 0.0 0.00 2.92
2004 2015 2.027561 TGGCGTCCTTAGCATTACTGTT 60.028 45.455 0.00 0.0 36.08 3.16
2105 2118 1.065126 CCAGGATCTGAAAGGACACCC 60.065 57.143 0.00 0.0 32.44 4.61


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.