Multiple sequence alignment - TraesCS4D01G145900

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G145900 chr4D 100.000 2341 0 0 1 2341 134961164 134963504 0 4324
1 TraesCS4D01G145900 chr4D 97.694 2342 47 6 1 2341 123399674 123402009 0 4019
2 TraesCS4D01G145900 chr7A 97.956 2348 35 7 1 2341 638509515 638507174 0 4058
3 TraesCS4D01G145900 chr7D 97.951 2343 40 5 1 2341 382087954 382090290 0 4054
4 TraesCS4D01G145900 chr7D 97.613 2346 42 7 1 2341 626713040 626710704 0 4010
5 TraesCS4D01G145900 chr7D 97.267 2342 55 5 1 2341 307034493 307032160 0 3962
6 TraesCS4D01G145900 chr7D 96.326 2341 74 5 1 2341 307161079 307163407 0 3836
7 TraesCS4D01G145900 chr6B 97.659 2349 41 7 1 2341 596603709 596601367 0 4021
8 TraesCS4D01G145900 chrUn 97.531 2349 44 7 1 2341 171006436 171008778 0 4004


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G145900 chr4D 134961164 134963504 2340 False 4324 4324 100.000 1 2341 1 chr4D.!!$F2 2340
1 TraesCS4D01G145900 chr4D 123399674 123402009 2335 False 4019 4019 97.694 1 2341 1 chr4D.!!$F1 2340
2 TraesCS4D01G145900 chr7A 638507174 638509515 2341 True 4058 4058 97.956 1 2341 1 chr7A.!!$R1 2340
3 TraesCS4D01G145900 chr7D 382087954 382090290 2336 False 4054 4054 97.951 1 2341 1 chr7D.!!$F2 2340
4 TraesCS4D01G145900 chr7D 626710704 626713040 2336 True 4010 4010 97.613 1 2341 1 chr7D.!!$R2 2340
5 TraesCS4D01G145900 chr7D 307032160 307034493 2333 True 3962 3962 97.267 1 2341 1 chr7D.!!$R1 2340
6 TraesCS4D01G145900 chr7D 307161079 307163407 2328 False 3836 3836 96.326 1 2341 1 chr7D.!!$F1 2340
7 TraesCS4D01G145900 chr6B 596601367 596603709 2342 True 4021 4021 97.659 1 2341 1 chr6B.!!$R1 2340
8 TraesCS4D01G145900 chrUn 171006436 171008778 2342 False 4004 4004 97.531 1 2341 1 chrUn.!!$F1 2340

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
981 990 0.537653 GCTTTCGGAGAAGGGTAGCT 59.462 55.0 0.0 0.0 45.9 3.32 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1959 1972 3.318557 GGGAAACAAAACGGAATGTACCA 59.681 43.478 0.0 0.0 31.89 3.25 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
124 125 1.615919 CCTTTACCGGAAATGCCACCT 60.616 52.381 9.46 0.0 35.94 4.00
180 186 1.928567 CCCCCTGGCCTAAACCTCA 60.929 63.158 3.32 0.0 0.00 3.86
294 300 8.319146 TGGAAGAATCGGACTCTAAGTTTAAAT 58.681 33.333 0.00 0.0 0.00 1.40
321 327 5.830991 GGAGTAGATTCTTTAGAGAGGCTCA 59.169 44.000 18.26 0.0 32.44 4.26
408 414 1.014564 GCAGAGCTGGTTACGTCCAC 61.015 60.000 0.00 0.0 33.55 4.02
410 416 1.816835 CAGAGCTGGTTACGTCCACTA 59.183 52.381 0.00 0.0 33.55 2.74
557 563 1.838715 ACTCCCTAGCGTCTCTACTCA 59.161 52.381 0.00 0.0 0.00 3.41
629 635 4.346127 GTCCATATTTAGGACGGTTAGGGT 59.654 45.833 0.00 0.0 45.35 4.34
981 990 0.537653 GCTTTCGGAGAAGGGTAGCT 59.462 55.000 0.00 0.0 45.90 3.32
1235 1248 2.370849 AGGTGACGGTTACAAGAATGGT 59.629 45.455 5.38 0.0 0.00 3.55
1304 1317 2.338809 TCGGGCAGGGATAATCATTCT 58.661 47.619 0.00 0.0 0.00 2.40
1350 1363 0.837691 TCTGAGCTGAGGGAAGCCAA 60.838 55.000 0.00 0.0 44.68 4.52
1369 1382 4.262164 GCCAACCAATTGAGTCACTGAAAT 60.262 41.667 7.12 0.0 38.15 2.17
1959 1972 5.703592 TGATGGTTGTACGTGCTAAAAATCT 59.296 36.000 4.97 0.0 0.00 2.40
1996 2009 5.319043 TGTTTCCCATCCTAGTCTTTTGT 57.681 39.130 0.00 0.0 0.00 2.83
2092 2106 5.594317 AGCTATTGCCGTTTCATTCCTATTT 59.406 36.000 0.00 0.0 40.80 1.40
2176 2190 6.479972 CCAGTGAGTGGTATTATTGGACTA 57.520 41.667 0.00 0.0 42.17 2.59
2337 2351 8.638873 GGGCAATTTGCTTTATACCTACTATTT 58.361 33.333 20.06 0.0 44.28 1.40
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
180 186 1.051812 CGGCTACTCTGGGATGGATT 58.948 55.000 0.00 0.00 0.00 3.01
252 258 6.391227 TTCTTCCAATTCTTCCAAAGACAC 57.609 37.500 0.00 0.00 37.23 3.67
294 300 7.588169 AGCCTCTCTAAAGAATCTACTCCTAA 58.412 38.462 0.00 0.00 0.00 2.69
305 311 6.153680 CCTTCTAAGTGAGCCTCTCTAAAGAA 59.846 42.308 15.24 15.24 0.00 2.52
315 321 6.670027 TCTCTTTATTCCTTCTAAGTGAGCCT 59.330 38.462 0.00 0.00 0.00 4.58
316 322 6.879400 TCTCTTTATTCCTTCTAAGTGAGCC 58.121 40.000 0.00 0.00 0.00 4.70
557 563 3.132289 TCCTCGAGATCGCATTTTAGGTT 59.868 43.478 15.71 0.00 39.60 3.50
1161 1174 3.835395 AGAGTGGACGAGAAAGAAAGGAT 59.165 43.478 0.00 0.00 0.00 3.24
1235 1248 1.652947 GGGTACTCTTCACTTCCCCA 58.347 55.000 0.00 0.00 0.00 4.96
1290 1303 3.654806 CCAGGACCAGAATGATTATCCCT 59.345 47.826 0.00 0.00 39.69 4.20
1350 1363 4.520492 GGTCATTTCAGTGACTCAATTGGT 59.480 41.667 5.42 2.31 46.02 3.67
1474 1487 2.434359 CCCGGTCGCCTTTCTGTC 60.434 66.667 0.00 0.00 0.00 3.51
1959 1972 3.318557 GGGAAACAAAACGGAATGTACCA 59.681 43.478 0.00 0.00 31.89 3.25
1996 2009 8.514330 ACAAAATAAGTAAACCAGAAGTGTCA 57.486 30.769 0.00 0.00 0.00 3.58
2176 2190 6.099557 TGAAGAACATTTCCCACCAAAAGATT 59.900 34.615 0.00 0.00 0.00 2.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.