Multiple sequence alignment - TraesCS4D01G140600

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G140600 chr4D 100.000 2414 0 0 1 2414 123738806 123736393 0 4458
1 TraesCS4D01G140600 chr4D 99.296 2416 12 4 1 2414 123509309 123506897 0 4362
2 TraesCS4D01G140600 chr4D 99.172 2416 15 4 1 2414 123656008 123653596 0 4346
3 TraesCS4D01G140600 chr4D 95.157 2416 107 9 1 2414 285094159 285096566 0 3805
4 TraesCS4D01G140600 chr7D 99.214 2416 13 5 1 2414 579028572 579030983 0 4351
5 TraesCS4D01G140600 chr6D 98.469 2416 32 5 1 2414 108466556 108468968 0 4252
6 TraesCS4D01G140600 chr6D 97.170 1484 37 4 1 1482 57920026 57921506 0 2503
7 TraesCS4D01G140600 chrUn 95.801 2429 66 22 1 2414 221549574 221547167 0 3888
8 TraesCS4D01G140600 chrUn 95.668 2424 79 19 1 2414 186192572 186190165 0 3871
9 TraesCS4D01G140600 chr7B 95.466 2426 81 21 1 2414 743004906 743007314 0 3843
10 TraesCS4D01G140600 chr7B 97.262 1461 36 3 1 1461 139543337 139541881 0 2473
11 TraesCS4D01G140600 chr7A 94.802 2424 90 20 1 2414 120879300 120881697 0 3746
12 TraesCS4D01G140600 chr7A 97.467 1461 34 3 1 1461 211291153 211292610 0 2490
13 TraesCS4D01G140600 chr5A 97.743 1462 31 2 1 1461 534932642 534934102 0 2516


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G140600 chr4D 123736393 123738806 2413 True 4458 4458 100.000 1 2414 1 chr4D.!!$R3 2413
1 TraesCS4D01G140600 chr4D 123506897 123509309 2412 True 4362 4362 99.296 1 2414 1 chr4D.!!$R1 2413
2 TraesCS4D01G140600 chr4D 123653596 123656008 2412 True 4346 4346 99.172 1 2414 1 chr4D.!!$R2 2413
3 TraesCS4D01G140600 chr4D 285094159 285096566 2407 False 3805 3805 95.157 1 2414 1 chr4D.!!$F1 2413
4 TraesCS4D01G140600 chr7D 579028572 579030983 2411 False 4351 4351 99.214 1 2414 1 chr7D.!!$F1 2413
5 TraesCS4D01G140600 chr6D 108466556 108468968 2412 False 4252 4252 98.469 1 2414 1 chr6D.!!$F2 2413
6 TraesCS4D01G140600 chr6D 57920026 57921506 1480 False 2503 2503 97.170 1 1482 1 chr6D.!!$F1 1481
7 TraesCS4D01G140600 chrUn 221547167 221549574 2407 True 3888 3888 95.801 1 2414 1 chrUn.!!$R2 2413
8 TraesCS4D01G140600 chrUn 186190165 186192572 2407 True 3871 3871 95.668 1 2414 1 chrUn.!!$R1 2413
9 TraesCS4D01G140600 chr7B 743004906 743007314 2408 False 3843 3843 95.466 1 2414 1 chr7B.!!$F1 2413
10 TraesCS4D01G140600 chr7B 139541881 139543337 1456 True 2473 2473 97.262 1 1461 1 chr7B.!!$R1 1460
11 TraesCS4D01G140600 chr7A 120879300 120881697 2397 False 3746 3746 94.802 1 2414 1 chr7A.!!$F1 2413
12 TraesCS4D01G140600 chr7A 211291153 211292610 1457 False 2490 2490 97.467 1 1461 1 chr7A.!!$F2 1460
13 TraesCS4D01G140600 chr5A 534932642 534934102 1460 False 2516 2516 97.743 1 1461 1 chr5A.!!$F1 1460

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
982 990 1.584724 CCTGGAAGACATACCTGGGT 58.415 55.0 0.0 0.0 40.18 4.51 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
2135 2161 0.534412 CATTGTAATTGCCCCGCCAA 59.466 50.0 0.0 0.0 0.0 4.52 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
384 387 4.219944 AGCATGAAGTAAGTTGTCGGTAGA 59.780 41.667 0.0 0.0 0.00 2.59
982 990 1.584724 CCTGGAAGACATACCTGGGT 58.415 55.000 0.0 0.0 40.18 4.51
1398 1411 9.907229 GAGGATCTTAGAAGGGAATTAGAAAAA 57.093 33.333 0.0 0.0 0.00 1.94
2135 2161 9.151177 TCCTACTTTTATTATCACTTCCGGTAT 57.849 33.333 0.0 0.0 0.00 2.73
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
384 387 4.082408 GCTTTTCCTTTTACCTAATGCCGT 60.082 41.667 0.00 0.0 0.00 5.68
797 805 1.005294 GCCGACGAAGCACGAACTAA 61.005 55.000 10.05 0.0 45.77 2.24
982 990 3.780294 TCCATTAGGAAGAGCTTAAGCCA 59.220 43.478 23.71 0.0 42.23 4.75
1041 1049 4.782019 TTGATAAAGCGCCACAAATTCT 57.218 36.364 2.29 0.0 0.00 2.40
1604 1630 0.330604 AAGCATGTGCCCATCACTCT 59.669 50.000 0.57 0.0 45.81 3.24
2135 2161 0.534412 CATTGTAATTGCCCCGCCAA 59.466 50.000 0.00 0.0 0.00 4.52


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.