Multiple sequence alignment - TraesCS4D01G140500

Loading Multiple Alignment...

Download Multiple Sequence Alignment: (Fasta) (Clustal)


BLAST Results


Shown here are the results of a BLAST search against the genome using the input sequence. The pipeline uses this to extract flanking regions for cloning. If the result of the multiple sequence alignment is not as expected, these results could be used for further investigation.

qseqid sseqid percentage.identical alignment.length no.mismatch no.gap.openings qstart qend sstart send evalue bitscore
0 TraesCS4D01G140500 chr4D 100.000 3197 0 0 1 3197 123731198 123728002 0.000000e+00 5904
1 TraesCS4D01G140500 chr4D 98.061 3197 59 3 1 3197 134969076 134972269 0.000000e+00 5557
2 TraesCS4D01G140500 chr7D 99.031 3199 28 2 1 3197 381882010 381878813 0.000000e+00 5733
3 TraesCS4D01G140500 chr7D 98.437 3198 43 3 1 3197 203530172 203526981 0.000000e+00 5622
4 TraesCS4D01G140500 chr7D 96.097 2485 93 4 1 2484 307185388 307182907 0.000000e+00 4048
5 TraesCS4D01G140500 chr7D 96.944 720 22 0 2478 3197 307179567 307178848 0.000000e+00 1208
6 TraesCS4D01G140500 chr7D 99.127 229 2 0 2115 2343 18404107 18404335 2.290000e-111 412
7 TraesCS4D01G140500 chr7D 97.647 85 2 0 2308 2392 404384564 404384480 2.570000e-31 147
8 TraesCS4D01G140500 chr2D 98.718 3199 38 2 1 3197 635019105 635022302 0.000000e+00 5677
9 TraesCS4D01G140500 chr2D 96.855 159 5 0 2338 2496 425290996 425291154 1.890000e-67 267
10 TraesCS4D01G140500 chr3D 97.591 3197 62 3 1 3197 501892039 501895220 0.000000e+00 5463
11 TraesCS4D01G140500 chrUn 98.947 2280 21 1 1 2277 223715546 223717825 0.000000e+00 4074
12 TraesCS4D01G140500 chrUn 99.077 1408 13 0 1765 3172 402971007 402972414 0.000000e+00 2529
13 TraesCS4D01G140500 chrUn 99.205 629 5 0 2569 3197 381709206 381708578 0.000000e+00 1134
14 TraesCS4D01G140500 chr2A 98.858 2190 22 2 1 2187 755521017 755518828 0.000000e+00 3903
15 TraesCS4D01G140500 chr5B 98.721 2189 25 2 1 2187 127798273 127796086 0.000000e+00 3884
16 TraesCS4D01G140500 chr6D 97.823 781 16 1 2418 3197 425976144 425976924 0.000000e+00 1347
17 TraesCS4D01G140500 chr6B 96.277 188 7 0 2415 2602 197526834 197526647 3.100000e-80 309


These results show the homologous regions that are presented in the multiple sequence alignment. HSPs from the BLAST search that are within 2000 bases of each other have been grouped together. Homologous regions that are purely upstream or downstream may be removed if they don't overlap both primers.

query scaffold start end length rev.comp avg.bitscore max.bitscore avg.percent.identical query.start query.end num_hsp groupid homo_length
0 TraesCS4D01G140500 chr4D 123728002 123731198 3196 True 5904 5904 100.0000 1 3197 1 chr4D.!!$R1 3196
1 TraesCS4D01G140500 chr4D 134969076 134972269 3193 False 5557 5557 98.0610 1 3197 1 chr4D.!!$F1 3196
2 TraesCS4D01G140500 chr7D 381878813 381882010 3197 True 5733 5733 99.0310 1 3197 1 chr7D.!!$R2 3196
3 TraesCS4D01G140500 chr7D 203526981 203530172 3191 True 5622 5622 98.4370 1 3197 1 chr7D.!!$R1 3196
4 TraesCS4D01G140500 chr7D 307178848 307185388 6540 True 2628 4048 96.5205 1 3197 2 chr7D.!!$R4 3196
5 TraesCS4D01G140500 chr2D 635019105 635022302 3197 False 5677 5677 98.7180 1 3197 1 chr2D.!!$F2 3196
6 TraesCS4D01G140500 chr3D 501892039 501895220 3181 False 5463 5463 97.5910 1 3197 1 chr3D.!!$F1 3196
7 TraesCS4D01G140500 chrUn 223715546 223717825 2279 False 4074 4074 98.9470 1 2277 1 chrUn.!!$F1 2276
8 TraesCS4D01G140500 chrUn 402971007 402972414 1407 False 2529 2529 99.0770 1765 3172 1 chrUn.!!$F2 1407
9 TraesCS4D01G140500 chrUn 381708578 381709206 628 True 1134 1134 99.2050 2569 3197 1 chrUn.!!$R1 628
10 TraesCS4D01G140500 chr2A 755518828 755521017 2189 True 3903 3903 98.8580 1 2187 1 chr2A.!!$R1 2186
11 TraesCS4D01G140500 chr5B 127796086 127798273 2187 True 3884 3884 98.7210 1 2187 1 chr5B.!!$R1 2186
12 TraesCS4D01G140500 chr6D 425976144 425976924 780 False 1347 1347 97.8230 2418 3197 1 chr6D.!!$F1 779

AutoCloner calculated primer pairs

These primer pairs were selected by Autocloner to minimize primer penalty (calculated by Primer3), whilst remaining within the specified product range where possible.

Download AutoCloner chosen primers as CSV: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
240 246 0.678395 ATGAGGCGATACAGCTGAGG 59.322 55.00 23.35 7.2 37.29 3.86 F
658 664 5.627499 TTCTTTGTTGAGATGGAAATCGG 57.373 39.13 0.00 0.0 0.00 4.18 F
1499 1508 6.312529 CCATACCAGTAGTAGGAGATACCAA 58.687 44.00 0.00 0.0 42.04 3.67 F
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability Orientation
1499 1508 0.261696 ACCCCAAAGCCAAGTCACTT 59.738 50.000 0.00 0.0 0.00 3.16 R
1595 1604 1.205655 CGGCCAGATGAAGAAGACTGA 59.794 52.381 2.24 0.0 32.90 3.41 R
2838 6196 0.382158 TCGCTATCGCTCCTGACTTG 59.618 55.000 0.00 0.0 35.26 3.16 R

All possible primers

Listed here are all possible primers based on the multiple sequence alignment and SNPs generated previously. A lower penalty score indicates a better primer. If the AutoCloner primers did not work during PCR or sequencing, these could be used as alternatives.

Download all possible primers: (Forward) (Reverse)
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
212 213 2.971261 GCCGTTTGTTTTCTCGCTTAAG 59.029 45.455 0.00 0.0 0.00 1.85
240 246 0.678395 ATGAGGCGATACAGCTGAGG 59.322 55.000 23.35 7.2 37.29 3.86
658 664 5.627499 TTCTTTGTTGAGATGGAAATCGG 57.373 39.130 0.00 0.0 0.00 4.18
1499 1508 6.312529 CCATACCAGTAGTAGGAGATACCAA 58.687 44.000 0.00 0.0 42.04 3.67
1595 1604 3.387012 TCCCCCTTATTTTAGTAGGCGT 58.613 45.455 0.00 0.0 0.00 5.68
1828 1837 0.107214 CACCCCGCCTCATATTGTGT 60.107 55.000 0.00 0.0 0.00 3.72
2124 2135 0.323816 TTGCCATAACGCCCATTCCA 60.324 50.000 0.00 0.0 0.00 3.53
2690 6048 4.159693 CCACTGTAGAATGTACCAGCACTA 59.840 45.833 0.00 0.0 0.00 2.74
2838 6196 8.947055 TTGTCTTTTATACCGGTTTCTATACC 57.053 34.615 15.04 0.0 34.72 2.73
2882 6240 2.584236 GCCTATAGGAGTCGAAGGACA 58.416 52.381 23.61 0.0 39.66 4.02
Position MSA Position Penalty Sequence TM GC Self any TH Self end TH Hairpin End Stability
12 13 4.440880 GAGAGTGACAAATGAGATGGAGG 58.559 47.826 0.00 0.00 0.00 4.30
212 213 5.696724 AGCTGTATCGCCTCATACAAATTAC 59.303 40.000 0.00 0.00 38.50 1.89
240 246 2.668280 GCTCGAACCGTTGGCTGAC 61.668 63.158 0.00 0.00 0.00 3.51
658 664 2.509052 AGCCCTTTTCAAAAGAACGC 57.491 45.000 11.73 9.48 0.00 4.84
1499 1508 0.261696 ACCCCAAAGCCAAGTCACTT 59.738 50.000 0.00 0.00 0.00 3.16
1595 1604 1.205655 CGGCCAGATGAAGAAGACTGA 59.794 52.381 2.24 0.00 32.90 3.41
2124 2135 2.011122 TTCCTCTTCCAACTCGTCCT 57.989 50.000 0.00 0.00 0.00 3.85
2430 2441 2.771943 CCTTCTAGCCTACACCAATGGA 59.228 50.000 6.16 0.00 0.00 3.41
2431 2442 2.505819 ACCTTCTAGCCTACACCAATGG 59.494 50.000 0.00 0.00 0.00 3.16
2690 6048 0.908198 CTAGCAGGCCTCTTTGACCT 59.092 55.000 0.00 0.00 0.00 3.85
2838 6196 0.382158 TCGCTATCGCTCCTGACTTG 59.618 55.000 0.00 0.00 35.26 3.16
2882 6240 4.822026 CTCATCAGGTCTAACGGACTTTT 58.178 43.478 0.00 0.00 43.97 2.27
2970 6328 4.099419 TCATCCACAGCTTCGCTAGATTTA 59.901 41.667 0.00 0.00 36.40 1.40


Based at the University of Bristol with support from BBSRC. BBSRC icon Bristol icon

AutoCloner maintained by Alex Coulton.